ID: 902106633

View in Genome Browser
Species Human (GRCh38)
Location 1:14042144-14042166
Sequence GAAAATTAGGTCAATCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902106633_902106636 11 Left 902106633 1:14042144-14042166 CCTCCTGGATTGACCTAATTTTC No data
Right 902106636 1:14042178-14042200 CTTCAGTTTTTTTTCCCTTTTGG No data
902106633_902106637 12 Left 902106633 1:14042144-14042166 CCTCCTGGATTGACCTAATTTTC No data
Right 902106637 1:14042179-14042201 TTCAGTTTTTTTTCCCTTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902106633 Original CRISPR GAAAATTAGGTCAATCCAGG AGG (reversed) Intergenic
No off target data available for this crispr