ID: 902106712

View in Genome Browser
Species Human (GRCh38)
Location 1:14043059-14043081
Sequence GGGGATTGAAGGAGTTTAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902106712_902106714 -10 Left 902106712 1:14043059-14043081 CCAACTAAACTCCTTCAATCCCC No data
Right 902106714 1:14043072-14043094 TTCAATCCCCACCCAGTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902106712 Original CRISPR GGGGATTGAAGGAGTTTAGT TGG (reversed) Intergenic
No off target data available for this crispr