ID: 902109672

View in Genome Browser
Species Human (GRCh38)
Location 1:14067755-14067777
Sequence TGGTTGCCCCAGAACTTTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902109672_902109682 21 Left 902109672 1:14067755-14067777 CCTTGAAAGTTCTGGGGCAACCA No data
Right 902109682 1:14067799-14067821 GATGTCACTGGGACTTGGTTTGG No data
902109672_902109678 10 Left 902109672 1:14067755-14067777 CCTTGAAAGTTCTGGGGCAACCA No data
Right 902109678 1:14067788-14067810 AGGGCACCCACGATGTCACTGGG No data
902109672_902109673 -10 Left 902109672 1:14067755-14067777 CCTTGAAAGTTCTGGGGCAACCA No data
Right 902109673 1:14067768-14067790 GGGGCAACCACAGCTGATCCAGG No data
902109672_902109680 16 Left 902109672 1:14067755-14067777 CCTTGAAAGTTCTGGGGCAACCA No data
Right 902109680 1:14067794-14067816 CCCACGATGTCACTGGGACTTGG No data
902109672_902109674 -9 Left 902109672 1:14067755-14067777 CCTTGAAAGTTCTGGGGCAACCA No data
Right 902109674 1:14067769-14067791 GGGCAACCACAGCTGATCCAGGG No data
902109672_902109677 9 Left 902109672 1:14067755-14067777 CCTTGAAAGTTCTGGGGCAACCA No data
Right 902109677 1:14067787-14067809 CAGGGCACCCACGATGTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902109672 Original CRISPR TGGTTGCCCCAGAACTTTCA AGG (reversed) Intergenic
No off target data available for this crispr