ID: 902111015

View in Genome Browser
Species Human (GRCh38)
Location 1:14078328-14078350
Sequence GCATCGTGATTGGCAGCAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902111011_902111015 9 Left 902111011 1:14078296-14078318 CCGCTAGATCTAAACTCCATCCA No data
Right 902111015 1:14078328-14078350 GCATCGTGATTGGCAGCAACAGG No data
902111012_902111015 -7 Left 902111012 1:14078312-14078334 CCATCCACAGCATTCAGCATCGT No data
Right 902111015 1:14078328-14078350 GCATCGTGATTGGCAGCAACAGG No data
902111010_902111015 10 Left 902111010 1:14078295-14078317 CCCGCTAGATCTAAACTCCATCC No data
Right 902111015 1:14078328-14078350 GCATCGTGATTGGCAGCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902111015 Original CRISPR GCATCGTGATTGGCAGCAAC AGG Intergenic
No off target data available for this crispr