ID: 902111210

View in Genome Browser
Species Human (GRCh38)
Location 1:14079996-14080018
Sequence ATGATCCCATCAACTCTCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902111208_902111210 0 Left 902111208 1:14079973-14079995 CCATTGATGGGAGCTCCATCTTC No data
Right 902111210 1:14079996-14080018 ATGATCCCATCAACTCTCAAAGG No data
902111205_902111210 23 Left 902111205 1:14079950-14079972 CCAAAGTATATTAGACATCACTG No data
Right 902111210 1:14079996-14080018 ATGATCCCATCAACTCTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902111210 Original CRISPR ATGATCCCATCAACTCTCAA AGG Intergenic
No off target data available for this crispr