ID: 902112945

View in Genome Browser
Species Human (GRCh38)
Location 1:14098443-14098465
Sequence GGAGCTCTGTTTGCAACAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902112942_902112945 8 Left 902112942 1:14098412-14098434 CCTATGCAGCTATAGTATGCTCC No data
Right 902112945 1:14098443-14098465 GGAGCTCTGTTTGCAACAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902112945 Original CRISPR GGAGCTCTGTTTGCAACAGA AGG Intergenic
No off target data available for this crispr