ID: 902114231

View in Genome Browser
Species Human (GRCh38)
Location 1:14107688-14107710
Sequence TTCCGCCCACCCTATCTCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902114231_902114232 0 Left 902114231 1:14107688-14107710 CCTATGAGATAGGGTGGGCGGAA No data
Right 902114232 1:14107711-14107733 GCTCCATTTTAACCAGATCATGG No data
902114231_902114235 29 Left 902114231 1:14107688-14107710 CCTATGAGATAGGGTGGGCGGAA No data
Right 902114235 1:14107740-14107762 AACTCATGAGCTTTGTATGCTGG No data
902114231_902114236 30 Left 902114231 1:14107688-14107710 CCTATGAGATAGGGTGGGCGGAA No data
Right 902114236 1:14107741-14107763 ACTCATGAGCTTTGTATGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902114231 Original CRISPR TTCCGCCCACCCTATCTCAT AGG (reversed) Intergenic
No off target data available for this crispr