ID: 902114232

View in Genome Browser
Species Human (GRCh38)
Location 1:14107711-14107733
Sequence GCTCCATTTTAACCAGATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902114231_902114232 0 Left 902114231 1:14107688-14107710 CCTATGAGATAGGGTGGGCGGAA No data
Right 902114232 1:14107711-14107733 GCTCCATTTTAACCAGATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902114232 Original CRISPR GCTCCATTTTAACCAGATCA TGG Intergenic
No off target data available for this crispr