ID: 902118557

View in Genome Browser
Species Human (GRCh38)
Location 1:14142087-14142109
Sequence AGGGAAGGAGGGAGGAAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902118557_902118568 22 Left 902118557 1:14142087-14142109 CCTCTTTTCCTCCCTCCTTCCCT No data
Right 902118568 1:14142132-14142154 CCTTAAAACCAGATGGAGGTAGG No data
902118557_902118570 30 Left 902118557 1:14142087-14142109 CCTCTTTTCCTCCCTCCTTCCCT No data
Right 902118570 1:14142140-14142162 CCAGATGGAGGTAGGTTTACAGG No data
902118557_902118566 18 Left 902118557 1:14142087-14142109 CCTCTTTTCCTCCCTCCTTCCCT No data
Right 902118566 1:14142128-14142150 CTTGCCTTAAAACCAGATGGAGG No data
902118557_902118565 15 Left 902118557 1:14142087-14142109 CCTCTTTTCCTCCCTCCTTCCCT No data
Right 902118565 1:14142125-14142147 TGGCTTGCCTTAAAACCAGATGG No data
902118557_902118562 -5 Left 902118557 1:14142087-14142109 CCTCTTTTCCTCCCTCCTTCCCT No data
Right 902118562 1:14142105-14142127 TCCCTTTTTTTTTTTTTTTTTGG 0: 25
1: 551
2: 3920
3: 23635
4: 34542

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902118557 Original CRISPR AGGGAAGGAGGGAGGAAAAG AGG (reversed) Intergenic
No off target data available for this crispr