ID: 902118558

View in Genome Browser
Species Human (GRCh38)
Location 1:14142095-14142117
Sequence AAAAAAAAAGGGAAGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902118558_902118568 14 Left 902118558 1:14142095-14142117 CCTCCCTCCTTCCCTTTTTTTTT No data
Right 902118568 1:14142132-14142154 CCTTAAAACCAGATGGAGGTAGG No data
902118558_902118570 22 Left 902118558 1:14142095-14142117 CCTCCCTCCTTCCCTTTTTTTTT No data
Right 902118570 1:14142140-14142162 CCAGATGGAGGTAGGTTTACAGG No data
902118558_902118565 7 Left 902118558 1:14142095-14142117 CCTCCCTCCTTCCCTTTTTTTTT No data
Right 902118565 1:14142125-14142147 TGGCTTGCCTTAAAACCAGATGG No data
902118558_902118566 10 Left 902118558 1:14142095-14142117 CCTCCCTCCTTCCCTTTTTTTTT No data
Right 902118566 1:14142128-14142150 CTTGCCTTAAAACCAGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902118558 Original CRISPR AAAAAAAAAGGGAAGGAGGG AGG (reversed) Intergenic
No off target data available for this crispr