ID: 902118559

View in Genome Browser
Species Human (GRCh38)
Location 1:14142098-14142120
Sequence AAAAAAAAAAAAGGGAAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 53242
Summary {0: 22, 1: 282, 2: 1484, 3: 9200, 4: 42254}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902118559_902118570 19 Left 902118559 1:14142098-14142120 CCCTCCTTCCCTTTTTTTTTTTT 0: 22
1: 282
2: 1484
3: 9200
4: 42254
Right 902118570 1:14142140-14142162 CCAGATGGAGGTAGGTTTACAGG No data
902118559_902118566 7 Left 902118559 1:14142098-14142120 CCCTCCTTCCCTTTTTTTTTTTT 0: 22
1: 282
2: 1484
3: 9200
4: 42254
Right 902118566 1:14142128-14142150 CTTGCCTTAAAACCAGATGGAGG No data
902118559_902118565 4 Left 902118559 1:14142098-14142120 CCCTCCTTCCCTTTTTTTTTTTT 0: 22
1: 282
2: 1484
3: 9200
4: 42254
Right 902118565 1:14142125-14142147 TGGCTTGCCTTAAAACCAGATGG No data
902118559_902118568 11 Left 902118559 1:14142098-14142120 CCCTCCTTCCCTTTTTTTTTTTT 0: 22
1: 282
2: 1484
3: 9200
4: 42254
Right 902118568 1:14142132-14142154 CCTTAAAACCAGATGGAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902118559 Original CRISPR AAAAAAAAAAAAGGGAAGGA GGG (reversed) Intergenic
Too many off-targets to display for this crispr