ID: 902118560

View in Genome Browser
Species Human (GRCh38)
Location 1:14142099-14142121
Sequence AAAAAAAAAAAAAGGGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 58972
Summary {0: 13, 1: 226, 2: 1822, 3: 11408, 4: 45503}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902118560_902118570 18 Left 902118560 1:14142099-14142121 CCTCCTTCCCTTTTTTTTTTTTT 0: 13
1: 226
2: 1822
3: 11408
4: 45503
Right 902118570 1:14142140-14142162 CCAGATGGAGGTAGGTTTACAGG No data
902118560_902118566 6 Left 902118560 1:14142099-14142121 CCTCCTTCCCTTTTTTTTTTTTT 0: 13
1: 226
2: 1822
3: 11408
4: 45503
Right 902118566 1:14142128-14142150 CTTGCCTTAAAACCAGATGGAGG No data
902118560_902118568 10 Left 902118560 1:14142099-14142121 CCTCCTTCCCTTTTTTTTTTTTT 0: 13
1: 226
2: 1822
3: 11408
4: 45503
Right 902118568 1:14142132-14142154 CCTTAAAACCAGATGGAGGTAGG No data
902118560_902118565 3 Left 902118560 1:14142099-14142121 CCTCCTTCCCTTTTTTTTTTTTT 0: 13
1: 226
2: 1822
3: 11408
4: 45503
Right 902118565 1:14142125-14142147 TGGCTTGCCTTAAAACCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902118560 Original CRISPR AAAAAAAAAAAAAGGGAAGG AGG (reversed) Intergenic
Too many off-targets to display for this crispr