ID: 902118561

View in Genome Browser
Species Human (GRCh38)
Location 1:14142102-14142124
Sequence AAAAAAAAAAAAAAAAGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 195604
Summary {0: 193, 1: 3190, 2: 20884, 3: 67855, 4: 103482}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902118561_902118570 15 Left 902118561 1:14142102-14142124 CCTTCCCTTTTTTTTTTTTTTTT 0: 193
1: 3190
2: 20884
3: 67855
4: 103482
Right 902118570 1:14142140-14142162 CCAGATGGAGGTAGGTTTACAGG No data
902118561_902118566 3 Left 902118561 1:14142102-14142124 CCTTCCCTTTTTTTTTTTTTTTT 0: 193
1: 3190
2: 20884
3: 67855
4: 103482
Right 902118566 1:14142128-14142150 CTTGCCTTAAAACCAGATGGAGG No data
902118561_902118568 7 Left 902118561 1:14142102-14142124 CCTTCCCTTTTTTTTTTTTTTTT 0: 193
1: 3190
2: 20884
3: 67855
4: 103482
Right 902118568 1:14142132-14142154 CCTTAAAACCAGATGGAGGTAGG No data
902118561_902118565 0 Left 902118561 1:14142102-14142124 CCTTCCCTTTTTTTTTTTTTTTT 0: 193
1: 3190
2: 20884
3: 67855
4: 103482
Right 902118565 1:14142125-14142147 TGGCTTGCCTTAAAACCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902118561 Original CRISPR AAAAAAAAAAAAAAAAGGGA AGG (reversed) Intergenic
Too many off-targets to display for this crispr