ID: 902118563

View in Genome Browser
Species Human (GRCh38)
Location 1:14142106-14142128
Sequence GCCAAAAAAAAAAAAAAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 96585
Summary {0: 54, 1: 759, 2: 7409, 3: 40592, 4: 47771}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902118563_902118568 3 Left 902118563 1:14142106-14142128 CCCTTTTTTTTTTTTTTTTTGGC 0: 54
1: 759
2: 7409
3: 40592
4: 47771
Right 902118568 1:14142132-14142154 CCTTAAAACCAGATGGAGGTAGG No data
902118563_902118570 11 Left 902118563 1:14142106-14142128 CCCTTTTTTTTTTTTTTTTTGGC 0: 54
1: 759
2: 7409
3: 40592
4: 47771
Right 902118570 1:14142140-14142162 CCAGATGGAGGTAGGTTTACAGG No data
902118563_902118566 -1 Left 902118563 1:14142106-14142128 CCCTTTTTTTTTTTTTTTTTGGC 0: 54
1: 759
2: 7409
3: 40592
4: 47771
Right 902118566 1:14142128-14142150 CTTGCCTTAAAACCAGATGGAGG No data
902118563_902118565 -4 Left 902118563 1:14142106-14142128 CCCTTTTTTTTTTTTTTTTTGGC 0: 54
1: 759
2: 7409
3: 40592
4: 47771
Right 902118565 1:14142125-14142147 TGGCTTGCCTTAAAACCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902118563 Original CRISPR GCCAAAAAAAAAAAAAAAAA GGG (reversed) Intergenic
Too many off-targets to display for this crispr