ID: 902118564

View in Genome Browser
Species Human (GRCh38)
Location 1:14142107-14142129
Sequence AGCCAAAAAAAAAAAAAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 88585
Summary {0: 19, 1: 278, 2: 1810, 3: 33902, 4: 52576}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902118564_902118566 -2 Left 902118564 1:14142107-14142129 CCTTTTTTTTTTTTTTTTTGGCT 0: 19
1: 278
2: 1810
3: 33902
4: 52576
Right 902118566 1:14142128-14142150 CTTGCCTTAAAACCAGATGGAGG No data
902118564_902118570 10 Left 902118564 1:14142107-14142129 CCTTTTTTTTTTTTTTTTTGGCT 0: 19
1: 278
2: 1810
3: 33902
4: 52576
Right 902118570 1:14142140-14142162 CCAGATGGAGGTAGGTTTACAGG No data
902118564_902118565 -5 Left 902118564 1:14142107-14142129 CCTTTTTTTTTTTTTTTTTGGCT 0: 19
1: 278
2: 1810
3: 33902
4: 52576
Right 902118565 1:14142125-14142147 TGGCTTGCCTTAAAACCAGATGG No data
902118564_902118568 2 Left 902118564 1:14142107-14142129 CCTTTTTTTTTTTTTTTTTGGCT 0: 19
1: 278
2: 1810
3: 33902
4: 52576
Right 902118568 1:14142132-14142154 CCTTAAAACCAGATGGAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902118564 Original CRISPR AGCCAAAAAAAAAAAAAAAA AGG (reversed) Intergenic
Too many off-targets to display for this crispr