ID: 902118570

View in Genome Browser
Species Human (GRCh38)
Location 1:14142140-14142162
Sequence CCAGATGGAGGTAGGTTTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902118559_902118570 19 Left 902118559 1:14142098-14142120 CCCTCCTTCCCTTTTTTTTTTTT 0: 22
1: 282
2: 1484
3: 9200
4: 42254
Right 902118570 1:14142140-14142162 CCAGATGGAGGTAGGTTTACAGG No data
902118563_902118570 11 Left 902118563 1:14142106-14142128 CCCTTTTTTTTTTTTTTTTTGGC 0: 54
1: 759
2: 7409
3: 40592
4: 47771
Right 902118570 1:14142140-14142162 CCAGATGGAGGTAGGTTTACAGG No data
902118560_902118570 18 Left 902118560 1:14142099-14142121 CCTCCTTCCCTTTTTTTTTTTTT 0: 13
1: 226
2: 1822
3: 11408
4: 45503
Right 902118570 1:14142140-14142162 CCAGATGGAGGTAGGTTTACAGG No data
902118564_902118570 10 Left 902118564 1:14142107-14142129 CCTTTTTTTTTTTTTTTTTGGCT 0: 19
1: 278
2: 1810
3: 33902
4: 52576
Right 902118570 1:14142140-14142162 CCAGATGGAGGTAGGTTTACAGG No data
902118558_902118570 22 Left 902118558 1:14142095-14142117 CCTCCCTCCTTCCCTTTTTTTTT No data
Right 902118570 1:14142140-14142162 CCAGATGGAGGTAGGTTTACAGG No data
902118557_902118570 30 Left 902118557 1:14142087-14142109 CCTCTTTTCCTCCCTCCTTCCCT No data
Right 902118570 1:14142140-14142162 CCAGATGGAGGTAGGTTTACAGG No data
902118561_902118570 15 Left 902118561 1:14142102-14142124 CCTTCCCTTTTTTTTTTTTTTTT 0: 193
1: 3190
2: 20884
3: 67855
4: 103482
Right 902118570 1:14142140-14142162 CCAGATGGAGGTAGGTTTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902118570 Original CRISPR CCAGATGGAGGTAGGTTTAC AGG Intergenic
No off target data available for this crispr