ID: 902124244

View in Genome Browser
Species Human (GRCh38)
Location 1:14195200-14195222
Sequence ATAAGGCTGTTCCTTCTTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902124241_902124244 9 Left 902124241 1:14195168-14195190 CCCTTCATTAATGGAGTGTTTCT No data
Right 902124244 1:14195200-14195222 ATAAGGCTGTTCCTTCTTCAAGG No data
902124242_902124244 8 Left 902124242 1:14195169-14195191 CCTTCATTAATGGAGTGTTTCTA No data
Right 902124244 1:14195200-14195222 ATAAGGCTGTTCCTTCTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902124244 Original CRISPR ATAAGGCTGTTCCTTCTTCA AGG Intergenic
No off target data available for this crispr