ID: 902125830

View in Genome Browser
Species Human (GRCh38)
Location 1:14210143-14210165
Sequence CATGAGAGGGACACAGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902125822_902125830 -5 Left 902125822 1:14210125-14210147 CCTATAATCCCCACATATCATGA No data
Right 902125830 1:14210143-14210165 CATGAGAGGGACACAGTGGGAGG No data
902125817_902125830 26 Left 902125817 1:14210094-14210116 CCCCACCCAAATCTCATCTTGAA 0: 7463
1: 11190
2: 9643
3: 7118
4: 4722
Right 902125830 1:14210143-14210165 CATGAGAGGGACACAGTGGGAGG No data
902125818_902125830 25 Left 902125818 1:14210095-14210117 CCCACCCAAATCTCATCTTGAAT 0: 7461
1: 10942
2: 10318
3: 7687
4: 6503
Right 902125830 1:14210143-14210165 CATGAGAGGGACACAGTGGGAGG No data
902125819_902125830 24 Left 902125819 1:14210096-14210118 CCACCCAAATCTCATCTTGAATT 0: 7468
1: 11239
2: 9760
3: 8452
4: 6791
Right 902125830 1:14210143-14210165 CATGAGAGGGACACAGTGGGAGG No data
902125820_902125830 21 Left 902125820 1:14210099-14210121 CCCAAATCTCATCTTGAATTGTA 0: 6802
1: 10434
2: 9513
3: 7783
4: 4679
Right 902125830 1:14210143-14210165 CATGAGAGGGACACAGTGGGAGG No data
902125821_902125830 20 Left 902125821 1:14210100-14210122 CCAAATCTCATCTTGAATTGTAG 0: 4048
1: 7216
2: 8939
3: 8984
4: 9244
Right 902125830 1:14210143-14210165 CATGAGAGGGACACAGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902125830 Original CRISPR CATGAGAGGGACACAGTGGG AGG Intergenic
No off target data available for this crispr