ID: 902127804

View in Genome Browser
Species Human (GRCh38)
Location 1:14231656-14231678
Sequence ACTGATAACCAGTTATTGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902127804_902127805 -4 Left 902127804 1:14231656-14231678 CCTAGCAATAACTGGTTATCAGT No data
Right 902127805 1:14231675-14231697 CAGTATCCAGTGTACCAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902127804 Original CRISPR ACTGATAACCAGTTATTGCT AGG (reversed) Intergenic
No off target data available for this crispr