ID: 902128319

View in Genome Browser
Species Human (GRCh38)
Location 1:14236481-14236503
Sequence TCAGGCTGCTCCTCAAATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902128306_902128319 25 Left 902128306 1:14236433-14236455 CCATTCTCTTCCTTTCATGGGAC No data
Right 902128319 1:14236481-14236503 TCAGGCTGCTCCTCAAATGCAGG No data
902128315_902128319 -6 Left 902128315 1:14236464-14236486 CCTGGCCGGGGCTTCCCTCAGGC No data
Right 902128319 1:14236481-14236503 TCAGGCTGCTCCTCAAATGCAGG No data
902128313_902128319 3 Left 902128313 1:14236455-14236477 CCACAGAGGCCTGGCCGGGGCTT No data
Right 902128319 1:14236481-14236503 TCAGGCTGCTCCTCAAATGCAGG No data
902128308_902128319 15 Left 902128308 1:14236443-14236465 CCTTTCATGGGACCACAGAGGCC No data
Right 902128319 1:14236481-14236503 TCAGGCTGCTCCTCAAATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902128319 Original CRISPR TCAGGCTGCTCCTCAAATGC AGG Intergenic
No off target data available for this crispr