ID: 902136999

View in Genome Browser
Species Human (GRCh38)
Location 1:14316066-14316088
Sequence GATGACTAAAGTTTAAAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902136999_902137001 -5 Left 902136999 1:14316066-14316088 CCAGTCTTTAAACTTTAGTCATC No data
Right 902137001 1:14316084-14316106 TCATCTGTGTGGATATGTATTGG No data
902136999_902137002 8 Left 902136999 1:14316066-14316088 CCAGTCTTTAAACTTTAGTCATC No data
Right 902137002 1:14316097-14316119 TATGTATTGGCATCCCTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902136999 Original CRISPR GATGACTAAAGTTTAAAGAC TGG (reversed) Intergenic
No off target data available for this crispr