ID: 902137636

View in Genome Browser
Species Human (GRCh38)
Location 1:14324044-14324066
Sequence TAGGGTGCACAGGTTGCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902137636_902137643 27 Left 902137636 1:14324044-14324066 CCCACAGCAACCTGTGCACCCTA No data
Right 902137643 1:14324094-14324116 TCTAAATGTGTATGTTCATTAGG No data
902137636_902137644 28 Left 902137636 1:14324044-14324066 CCCACAGCAACCTGTGCACCCTA No data
Right 902137644 1:14324095-14324117 CTAAATGTGTATGTTCATTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902137636 Original CRISPR TAGGGTGCACAGGTTGCTGT GGG (reversed) Intergenic
No off target data available for this crispr