ID: 902141793

View in Genome Browser
Species Human (GRCh38)
Location 1:14362942-14362964
Sequence CCTTTGCCATCATGCCATTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902141793_902141797 -7 Left 902141793 1:14362942-14362964 CCCCAATGGCATGATGGCAAAGG No data
Right 902141797 1:14362958-14362980 GCAAAGGCAGCACAGAACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902141793 Original CRISPR CCTTTGCCATCATGCCATTG GGG (reversed) Intergenic
No off target data available for this crispr