ID: 902141797

View in Genome Browser
Species Human (GRCh38)
Location 1:14362958-14362980
Sequence GCAAAGGCAGCACAGAACTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902141793_902141797 -7 Left 902141793 1:14362942-14362964 CCCCAATGGCATGATGGCAAAGG No data
Right 902141797 1:14362958-14362980 GCAAAGGCAGCACAGAACTTTGG No data
902141789_902141797 6 Left 902141789 1:14362929-14362951 CCTCCATGAGGTCCCCCAATGGC No data
Right 902141797 1:14362958-14362980 GCAAAGGCAGCACAGAACTTTGG No data
902141796_902141797 -9 Left 902141796 1:14362944-14362966 CCAATGGCATGATGGCAAAGGCA No data
Right 902141797 1:14362958-14362980 GCAAAGGCAGCACAGAACTTTGG No data
902141790_902141797 3 Left 902141790 1:14362932-14362954 CCATGAGGTCCCCCAATGGCATG No data
Right 902141797 1:14362958-14362980 GCAAAGGCAGCACAGAACTTTGG No data
902141792_902141797 -6 Left 902141792 1:14362941-14362963 CCCCCAATGGCATGATGGCAAAG No data
Right 902141797 1:14362958-14362980 GCAAAGGCAGCACAGAACTTTGG No data
902141795_902141797 -8 Left 902141795 1:14362943-14362965 CCCAATGGCATGATGGCAAAGGC No data
Right 902141797 1:14362958-14362980 GCAAAGGCAGCACAGAACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902141797 Original CRISPR GCAAAGGCAGCACAGAACTT TGG Intergenic
No off target data available for this crispr