ID: 902146832

View in Genome Browser
Species Human (GRCh38)
Location 1:14408764-14408786
Sequence AGGGACCTTCTCTGGTGCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902146832_902146835 -4 Left 902146832 1:14408764-14408786 CCATAGCACCAGAGAAGGTCCCT No data
Right 902146835 1:14408783-14408805 CCCTGCATCATCCATTCTAGAGG No data
902146832_902146837 -3 Left 902146832 1:14408764-14408786 CCATAGCACCAGAGAAGGTCCCT No data
Right 902146837 1:14408784-14408806 CCTGCATCATCCATTCTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902146832 Original CRISPR AGGGACCTTCTCTGGTGCTA TGG (reversed) Intergenic
No off target data available for this crispr