ID: 902147038

View in Genome Browser
Species Human (GRCh38)
Location 1:14410809-14410831
Sequence CGGCCACCAGAACCCGAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902147032_902147038 21 Left 902147032 1:14410765-14410787 CCTTGGAGATGAGAGTGGTGTGG No data
Right 902147038 1:14410809-14410831 CGGCCACCAGAACCCGAAAGAGG No data
902147036_902147038 -9 Left 902147036 1:14410795-14410817 CCAAAAGATGCCAGCGGCCACCA No data
Right 902147038 1:14410809-14410831 CGGCCACCAGAACCCGAAAGAGG No data
902147034_902147038 -2 Left 902147034 1:14410788-14410810 CCAATAACCAAAAGATGCCAGCG No data
Right 902147038 1:14410809-14410831 CGGCCACCAGAACCCGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902147038 Original CRISPR CGGCCACCAGAACCCGAAAG AGG Intergenic
No off target data available for this crispr