ID: 902148629

View in Genome Browser
Species Human (GRCh38)
Location 1:14424538-14424560
Sequence CCATGTGAATGGCCGTGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902148629_902148632 -7 Left 902148629 1:14424538-14424560 CCACTGCACGGCCATTCACATGG No data
Right 902148632 1:14424554-14424576 CACATGGACACTGACATAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902148629 Original CRISPR CCATGTGAATGGCCGTGCAG TGG (reversed) Intergenic
No off target data available for this crispr