ID: 902149399

View in Genome Browser
Species Human (GRCh38)
Location 1:14430726-14430748
Sequence GCTGCTTGTGCTCAGCACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902149399_902149402 5 Left 902149399 1:14430726-14430748 CCAGGGTGCTGAGCACAAGCAGC No data
Right 902149402 1:14430754-14430776 TGAGAAGTGACTTCACAGAGAGG No data
902149399_902149403 10 Left 902149399 1:14430726-14430748 CCAGGGTGCTGAGCACAAGCAGC No data
Right 902149403 1:14430759-14430781 AGTGACTTCACAGAGAGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902149399 Original CRISPR GCTGCTTGTGCTCAGCACCC TGG (reversed) Intergenic
No off target data available for this crispr