ID: 902149402

View in Genome Browser
Species Human (GRCh38)
Location 1:14430754-14430776
Sequence TGAGAAGTGACTTCACAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902149395_902149402 27 Left 902149395 1:14430704-14430726 CCTAAGTCCTGCAGGACTCACAC No data
Right 902149402 1:14430754-14430776 TGAGAAGTGACTTCACAGAGAGG No data
902149399_902149402 5 Left 902149399 1:14430726-14430748 CCAGGGTGCTGAGCACAAGCAGC No data
Right 902149402 1:14430754-14430776 TGAGAAGTGACTTCACAGAGAGG No data
902149398_902149402 20 Left 902149398 1:14430711-14430733 CCTGCAGGACTCACACCAGGGTG No data
Right 902149402 1:14430754-14430776 TGAGAAGTGACTTCACAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902149402 Original CRISPR TGAGAAGTGACTTCACAGAG AGG Intergenic
No off target data available for this crispr