ID: 902149506

View in Genome Browser
Species Human (GRCh38)
Location 1:14431613-14431635
Sequence CTGCTTTGTTCTAGCAATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902149506_902149511 18 Left 902149506 1:14431613-14431635 CCAGCATTGCTAGAACAAAGCAG No data
Right 902149511 1:14431654-14431676 ACCTTGCTAGCTGGGTCTTCTGG No data
902149506_902149508 -9 Left 902149506 1:14431613-14431635 CCAGCATTGCTAGAACAAAGCAG No data
Right 902149508 1:14431627-14431649 ACAAAGCAGGCAGAAGAAGATGG No data
902149506_902149510 10 Left 902149506 1:14431613-14431635 CCAGCATTGCTAGAACAAAGCAG No data
Right 902149510 1:14431646-14431668 ATGGAATAACCTTGCTAGCTGGG No data
902149506_902149509 9 Left 902149506 1:14431613-14431635 CCAGCATTGCTAGAACAAAGCAG No data
Right 902149509 1:14431645-14431667 GATGGAATAACCTTGCTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902149506 Original CRISPR CTGCTTTGTTCTAGCAATGC TGG (reversed) Intergenic
No off target data available for this crispr