ID: 902150232

View in Genome Browser
Species Human (GRCh38)
Location 1:14436997-14437019
Sequence GCTTCTTTTACCAACTACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902150230_902150232 -7 Left 902150230 1:14436981-14437003 CCTGCCTGACACTTCAGCTTCTT No data
Right 902150232 1:14436997-14437019 GCTTCTTTTACCAACTACCCTGG No data
902150228_902150232 1 Left 902150228 1:14436973-14436995 CCTGTTTCCCTGCCTGACACTTC No data
Right 902150232 1:14436997-14437019 GCTTCTTTTACCAACTACCCTGG No data
902150229_902150232 -6 Left 902150229 1:14436980-14437002 CCCTGCCTGACACTTCAGCTTCT No data
Right 902150232 1:14436997-14437019 GCTTCTTTTACCAACTACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902150232 Original CRISPR GCTTCTTTTACCAACTACCC TGG Intergenic
No off target data available for this crispr