ID: 902151018

View in Genome Browser
Species Human (GRCh38)
Location 1:14443403-14443425
Sequence ACACATCCAGAGATGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902151008_902151018 27 Left 902151008 1:14443353-14443375 CCAGCAGTCTACCTCTGTGGGCC No data
Right 902151018 1:14443403-14443425 ACACATCCAGAGATGGAGGATGG No data
902151015_902151018 6 Left 902151015 1:14443374-14443396 CCAGGGGCTCTTGGGAGATAAGA No data
Right 902151018 1:14443403-14443425 ACACATCCAGAGATGGAGGATGG No data
902151012_902151018 16 Left 902151012 1:14443364-14443386 CCTCTGTGGGCCAGGGGCTCTTG No data
Right 902151018 1:14443403-14443425 ACACATCCAGAGATGGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902151018 Original CRISPR ACACATCCAGAGATGGAGGA TGG Intergenic
No off target data available for this crispr