ID: 902153404

View in Genome Browser
Species Human (GRCh38)
Location 1:14463105-14463127
Sequence GGGTGGGTTAATGCAAATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902153398_902153404 3 Left 902153398 1:14463079-14463101 CCACTTTTAATTACATGCAAATT 0: 61
1: 176
2: 260
3: 217
4: 542
Right 902153404 1:14463105-14463127 GGGTGGGTTAATGCAAATTGAGG No data
902153397_902153404 4 Left 902153397 1:14463078-14463100 CCCACTTTTAATTACATGCAAAT 0: 70
1: 178
2: 280
3: 215
4: 507
Right 902153404 1:14463105-14463127 GGGTGGGTTAATGCAAATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902153404 Original CRISPR GGGTGGGTTAATGCAAATTG AGG Intergenic
No off target data available for this crispr