ID: 902154189

View in Genome Browser
Species Human (GRCh38)
Location 1:14470623-14470645
Sequence AGAAAGGTGCTCACTTACGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902154189_902154195 26 Left 902154189 1:14470623-14470645 CCTGCGTAAGTGAGCACCTTTCT No data
Right 902154195 1:14470672-14470694 CAGGAAAAGGAAGGTAGAGGTGG No data
902154189_902154193 17 Left 902154189 1:14470623-14470645 CCTGCGTAAGTGAGCACCTTTCT No data
Right 902154193 1:14470663-14470685 CTTTGTTTGCAGGAAAAGGAAGG No data
902154189_902154191 7 Left 902154189 1:14470623-14470645 CCTGCGTAAGTGAGCACCTTTCT No data
Right 902154191 1:14470653-14470675 GCAGAGTTTACTTTGTTTGCAGG No data
902154189_902154194 23 Left 902154189 1:14470623-14470645 CCTGCGTAAGTGAGCACCTTTCT No data
Right 902154194 1:14470669-14470691 TTGCAGGAAAAGGAAGGTAGAGG No data
902154189_902154192 13 Left 902154189 1:14470623-14470645 CCTGCGTAAGTGAGCACCTTTCT No data
Right 902154192 1:14470659-14470681 TTTACTTTGTTTGCAGGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902154189 Original CRISPR AGAAAGGTGCTCACTTACGC AGG (reversed) Intergenic
No off target data available for this crispr