ID: 902154190

View in Genome Browser
Species Human (GRCh38)
Location 1:14470639-14470661
Sequence AAACTCTGCTCAACAGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902154190_902154196 25 Left 902154190 1:14470639-14470661 CCTTTCTCTGTTGAGCAGAGTTT No data
Right 902154196 1:14470687-14470709 AGAGGTGGATATGAAGAGTGTGG No data
902154190_902154193 1 Left 902154190 1:14470639-14470661 CCTTTCTCTGTTGAGCAGAGTTT No data
Right 902154193 1:14470663-14470685 CTTTGTTTGCAGGAAAAGGAAGG No data
902154190_902154194 7 Left 902154190 1:14470639-14470661 CCTTTCTCTGTTGAGCAGAGTTT No data
Right 902154194 1:14470669-14470691 TTGCAGGAAAAGGAAGGTAGAGG No data
902154190_902154191 -9 Left 902154190 1:14470639-14470661 CCTTTCTCTGTTGAGCAGAGTTT No data
Right 902154191 1:14470653-14470675 GCAGAGTTTACTTTGTTTGCAGG No data
902154190_902154197 26 Left 902154190 1:14470639-14470661 CCTTTCTCTGTTGAGCAGAGTTT No data
Right 902154197 1:14470688-14470710 GAGGTGGATATGAAGAGTGTGGG No data
902154190_902154195 10 Left 902154190 1:14470639-14470661 CCTTTCTCTGTTGAGCAGAGTTT No data
Right 902154195 1:14470672-14470694 CAGGAAAAGGAAGGTAGAGGTGG No data
902154190_902154192 -3 Left 902154190 1:14470639-14470661 CCTTTCTCTGTTGAGCAGAGTTT No data
Right 902154192 1:14470659-14470681 TTTACTTTGTTTGCAGGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902154190 Original CRISPR AAACTCTGCTCAACAGAGAA AGG (reversed) Intergenic
No off target data available for this crispr