ID: 902154193

View in Genome Browser
Species Human (GRCh38)
Location 1:14470663-14470685
Sequence CTTTGTTTGCAGGAAAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902154190_902154193 1 Left 902154190 1:14470639-14470661 CCTTTCTCTGTTGAGCAGAGTTT No data
Right 902154193 1:14470663-14470685 CTTTGTTTGCAGGAAAAGGAAGG No data
902154189_902154193 17 Left 902154189 1:14470623-14470645 CCTGCGTAAGTGAGCACCTTTCT No data
Right 902154193 1:14470663-14470685 CTTTGTTTGCAGGAAAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902154193 Original CRISPR CTTTGTTTGCAGGAAAAGGA AGG Intergenic
No off target data available for this crispr