ID: 902155465

View in Genome Browser
Species Human (GRCh38)
Location 1:14482053-14482075
Sequence CGACATTGCCTGGCACCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902155465_902155471 21 Left 902155465 1:14482053-14482075 CCAACAGGTGCCAGGCAATGTCG No data
Right 902155471 1:14482097-14482119 CGGTGAGCTGCATGGATAGATGG No data
902155465_902155469 1 Left 902155465 1:14482053-14482075 CCAACAGGTGCCAGGCAATGTCG No data
Right 902155469 1:14482077-14482099 ACAGCTTGAGGAGCATGCAGCGG No data
902155465_902155472 28 Left 902155465 1:14482053-14482075 CCAACAGGTGCCAGGCAATGTCG No data
Right 902155472 1:14482104-14482126 CTGCATGGATAGATGGCCAAAGG No data
902155465_902155470 13 Left 902155465 1:14482053-14482075 CCAACAGGTGCCAGGCAATGTCG No data
Right 902155470 1:14482089-14482111 GCATGCAGCGGTGAGCTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902155465 Original CRISPR CGACATTGCCTGGCACCTGT TGG (reversed) Intergenic
No off target data available for this crispr