ID: 902155472

View in Genome Browser
Species Human (GRCh38)
Location 1:14482104-14482126
Sequence CTGCATGGATAGATGGCCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902155465_902155472 28 Left 902155465 1:14482053-14482075 CCAACAGGTGCCAGGCAATGTCG No data
Right 902155472 1:14482104-14482126 CTGCATGGATAGATGGCCAAAGG No data
902155467_902155472 18 Left 902155467 1:14482063-14482085 CCAGGCAATGTCGGACAGCTTGA No data
Right 902155472 1:14482104-14482126 CTGCATGGATAGATGGCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902155472 Original CRISPR CTGCATGGATAGATGGCCAA AGG Intergenic
No off target data available for this crispr