ID: 902156987

View in Genome Browser
Species Human (GRCh38)
Location 1:14495692-14495714
Sequence CATTTCCTCCTGATTTCCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902156987_902156992 26 Left 902156987 1:14495692-14495714 CCTCGGGAAATCAGGAGGAAATG No data
Right 902156992 1:14495741-14495763 GATCCACCATTGACTTGGTTAGG No data
902156987_902156991 21 Left 902156987 1:14495692-14495714 CCTCGGGAAATCAGGAGGAAATG No data
Right 902156991 1:14495736-14495758 TCAGTGATCCACCATTGACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902156987 Original CRISPR CATTTCCTCCTGATTTCCCG AGG (reversed) Intergenic
No off target data available for this crispr