ID: 902156991

View in Genome Browser
Species Human (GRCh38)
Location 1:14495736-14495758
Sequence TCAGTGATCCACCATTGACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902156989_902156991 -7 Left 902156989 1:14495720-14495742 CCCAGGAACATGTATCTCAGTGA No data
Right 902156991 1:14495736-14495758 TCAGTGATCCACCATTGACTTGG No data
902156990_902156991 -8 Left 902156990 1:14495721-14495743 CCAGGAACATGTATCTCAGTGAT No data
Right 902156991 1:14495736-14495758 TCAGTGATCCACCATTGACTTGG No data
902156987_902156991 21 Left 902156987 1:14495692-14495714 CCTCGGGAAATCAGGAGGAAATG No data
Right 902156991 1:14495736-14495758 TCAGTGATCCACCATTGACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902156991 Original CRISPR TCAGTGATCCACCATTGACT TGG Intergenic
No off target data available for this crispr