ID: 902161154

View in Genome Browser
Species Human (GRCh38)
Location 1:14531462-14531484
Sequence ACCCATCAGGATCACGTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902161146_902161154 25 Left 902161146 1:14531414-14531436 CCCCACCATCATTACTCTCACTA No data
Right 902161154 1:14531462-14531484 ACCCATCAGGATCACGTTGTGGG No data
902161149_902161154 20 Left 902161149 1:14531419-14531441 CCATCATTACTCTCACTAGACAA No data
Right 902161154 1:14531462-14531484 ACCCATCAGGATCACGTTGTGGG No data
902161148_902161154 23 Left 902161148 1:14531416-14531438 CCACCATCATTACTCTCACTAGA No data
Right 902161154 1:14531462-14531484 ACCCATCAGGATCACGTTGTGGG No data
902161147_902161154 24 Left 902161147 1:14531415-14531437 CCCACCATCATTACTCTCACTAG No data
Right 902161154 1:14531462-14531484 ACCCATCAGGATCACGTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902161154 Original CRISPR ACCCATCAGGATCACGTTGT GGG Intergenic
No off target data available for this crispr