ID: 902162195

View in Genome Browser
Species Human (GRCh38)
Location 1:14540021-14540043
Sequence CTGTATTACTAGGGGAGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902162187_902162195 5 Left 902162187 1:14539993-14540015 CCATCCCCAGCTTTCTAAGTAGA No data
Right 902162195 1:14540021-14540043 CTGTATTACTAGGGGAGAGAGGG No data
902162188_902162195 1 Left 902162188 1:14539997-14540019 CCCCAGCTTTCTAAGTAGAATTC No data
Right 902162195 1:14540021-14540043 CTGTATTACTAGGGGAGAGAGGG No data
902162185_902162195 28 Left 902162185 1:14539970-14539992 CCCATTGTGTATAAACTCGCTCA No data
Right 902162195 1:14540021-14540043 CTGTATTACTAGGGGAGAGAGGG No data
902162189_902162195 0 Left 902162189 1:14539998-14540020 CCCAGCTTTCTAAGTAGAATTCT No data
Right 902162195 1:14540021-14540043 CTGTATTACTAGGGGAGAGAGGG No data
902162190_902162195 -1 Left 902162190 1:14539999-14540021 CCAGCTTTCTAAGTAGAATTCTC No data
Right 902162195 1:14540021-14540043 CTGTATTACTAGGGGAGAGAGGG No data
902162186_902162195 27 Left 902162186 1:14539971-14539993 CCATTGTGTATAAACTCGCTCAC No data
Right 902162195 1:14540021-14540043 CTGTATTACTAGGGGAGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902162195 Original CRISPR CTGTATTACTAGGGGAGAGA GGG Intergenic
No off target data available for this crispr