ID: 902164542

View in Genome Browser
Species Human (GRCh38)
Location 1:14559644-14559666
Sequence TTCTGAGCCCTCAATGGAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902164542_902164544 15 Left 902164542 1:14559644-14559666 CCATTTCCATTGAGGGCTCAGAA No data
Right 902164544 1:14559682-14559704 TTCAGTCCTTCCCTAGTTAGAGG No data
902164542_902164545 20 Left 902164542 1:14559644-14559666 CCATTTCCATTGAGGGCTCAGAA No data
Right 902164545 1:14559687-14559709 TCCTTCCCTAGTTAGAGGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902164542 Original CRISPR TTCTGAGCCCTCAATGGAAA TGG (reversed) Intergenic
No off target data available for this crispr