ID: 902164544

View in Genome Browser
Species Human (GRCh38)
Location 1:14559682-14559704
Sequence TTCAGTCCTTCCCTAGTTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902164543_902164544 9 Left 902164543 1:14559650-14559672 CCATTGAGGGCTCAGAAAGCACA No data
Right 902164544 1:14559682-14559704 TTCAGTCCTTCCCTAGTTAGAGG No data
902164542_902164544 15 Left 902164542 1:14559644-14559666 CCATTTCCATTGAGGGCTCAGAA No data
Right 902164544 1:14559682-14559704 TTCAGTCCTTCCCTAGTTAGAGG No data
902164541_902164544 20 Left 902164541 1:14559639-14559661 CCAATCCATTTCCATTGAGGGCT No data
Right 902164544 1:14559682-14559704 TTCAGTCCTTCCCTAGTTAGAGG No data
902164538_902164544 29 Left 902164538 1:14559630-14559652 CCAGAGCTTCCAATCCATTTCCA No data
Right 902164544 1:14559682-14559704 TTCAGTCCTTCCCTAGTTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902164544 Original CRISPR TTCAGTCCTTCCCTAGTTAG AGG Intergenic
No off target data available for this crispr