ID: 902167763

View in Genome Browser
Species Human (GRCh38)
Location 1:14586008-14586030
Sequence GACACAGCTGTTCCCTAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902167759_902167763 8 Left 902167759 1:14585977-14585999 CCTCCTGGGAGATCAAAATCAAT No data
Right 902167763 1:14586008-14586030 GACACAGCTGTTCCCTAGTGGGG No data
902167754_902167763 30 Left 902167754 1:14585955-14585977 CCGTGTGCAAAGAAACCAGGTCC No data
Right 902167763 1:14586008-14586030 GACACAGCTGTTCCCTAGTGGGG No data
902167760_902167763 5 Left 902167760 1:14585980-14586002 CCTGGGAGATCAAAATCAATTTT No data
Right 902167763 1:14586008-14586030 GACACAGCTGTTCCCTAGTGGGG No data
902167757_902167763 15 Left 902167757 1:14585970-14585992 CCAGGTCCCTCCTGGGAGATCAA No data
Right 902167763 1:14586008-14586030 GACACAGCTGTTCCCTAGTGGGG No data
902167758_902167763 9 Left 902167758 1:14585976-14585998 CCCTCCTGGGAGATCAAAATCAA No data
Right 902167763 1:14586008-14586030 GACACAGCTGTTCCCTAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902167763 Original CRISPR GACACAGCTGTTCCCTAGTG GGG Intergenic
No off target data available for this crispr