ID: 902168355

View in Genome Browser
Species Human (GRCh38)
Location 1:14590938-14590960
Sequence GAGGGGTAGCTCCAATGCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902168355_902168361 -4 Left 902168355 1:14590938-14590960 CCTATGCATTGGAGCTACCCCTC No data
Right 902168361 1:14590957-14590979 CCTCCCCCGACACCAAAGGCGGG No data
902168355_902168359 -5 Left 902168355 1:14590938-14590960 CCTATGCATTGGAGCTACCCCTC No data
Right 902168359 1:14590956-14590978 CCCTCCCCCGACACCAAAGGCGG No data
902168355_902168356 -8 Left 902168355 1:14590938-14590960 CCTATGCATTGGAGCTACCCCTC No data
Right 902168356 1:14590953-14590975 TACCCCTCCCCCGACACCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902168355 Original CRISPR GAGGGGTAGCTCCAATGCAT AGG (reversed) Intergenic
No off target data available for this crispr