ID: 902169456

View in Genome Browser
Species Human (GRCh38)
Location 1:14598620-14598642
Sequence TTCGCCGCCGGCTCGGGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 85}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902169456_902169470 27 Left 902169456 1:14598620-14598642 CCCCCTCCCGAGCCGGCGGCGAA 0: 1
1: 0
2: 0
3: 3
4: 85
Right 902169470 1:14598670-14598692 GTGGCGCGCGGTGTCCTTCTTGG 0: 1
1: 0
2: 0
3: 2
4: 46
902169456_902169465 5 Left 902169456 1:14598620-14598642 CCCCCTCCCGAGCCGGCGGCGAA 0: 1
1: 0
2: 0
3: 3
4: 85
Right 902169465 1:14598648-14598670 GGCTCCATTTAAAGAGTGCCTGG 0: 1
1: 0
2: 1
3: 14
4: 84
902169456_902169466 8 Left 902169456 1:14598620-14598642 CCCCCTCCCGAGCCGGCGGCGAA 0: 1
1: 0
2: 0
3: 3
4: 85
Right 902169466 1:14598651-14598673 TCCATTTAAAGAGTGCCTGGTGG 0: 1
1: 0
2: 0
3: 8
4: 149
902169456_902169468 15 Left 902169456 1:14598620-14598642 CCCCCTCCCGAGCCGGCGGCGAA 0: 1
1: 0
2: 0
3: 3
4: 85
Right 902169468 1:14598658-14598680 AAAGAGTGCCTGGTGGCGCGCGG 0: 1
1: 0
2: 0
3: 4
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902169456 Original CRISPR TTCGCCGCCGGCTCGGGAGG GGG (reversed) Intergenic
902169456 1:14598620-14598642 TTCGCCGCCGGCTCGGGAGGGGG - Intergenic
904863962 1:33561857-33561879 TTTGCAGCCAGCTCGGGAGAGGG + Intronic
915616841 1:157045792-157045814 TTCGCCGCTCGCTCGGGCGCAGG + Intergenic
915740185 1:158113416-158113438 CGCGCCGCCCGCTCGGCAGGGGG + Intergenic
920333322 1:205227951-205227973 CTCGCCGCGGGCTCGGGCCGCGG + Intergenic
922648739 1:227318566-227318588 TTGGCCGCCGGCTGGGGCTGAGG - Intergenic
1073098926 10:100997135-100997157 TTCGGAGCCGGCTAGGGAGCCGG + Intronic
1073196441 10:101695152-101695174 ACCGCCGCCGCCCCGGGAGGAGG + Exonic
1074818699 10:117163534-117163556 TGCGCCGACGGCTGGGGACGCGG + Intergenic
1080458158 11:32433460-32433482 TTCGCCCAAGGCTCGGGAGAAGG - Intronic
1083478121 11:62926835-62926857 TTGGCCTCCGCCTCGGGGGGTGG - Intergenic
1094056602 12:26274813-26274835 TGCGCCTCCTTCTCGGGAGGAGG + Intronic
1096585735 12:52618414-52618436 TTTGCCCCCTGCTCGGTAGGAGG + Exonic
1102101337 12:110281198-110281220 TTCGCCGCCGCCGCGGCATGTGG - Intronic
1103932567 12:124458349-124458371 TTCTCCGGGGGCTGGGGAGGGGG - Intronic
1104923166 12:132301575-132301597 TTCACCGCCGGCACAGCAGGAGG + Intronic
1106087552 13:26557455-26557477 TCCGCCCCCAGCTCGGGATGAGG - Intergenic
1106411019 13:29511588-29511610 TTGGCAGCTGGCTCGGGAGCCGG - Exonic
1116916665 14:50532327-50532349 TTCGCGGGCGGCCGGGGAGGGGG - Intronic
1116980084 14:51160066-51160088 TTCGCCTCAGGCCTGGGAGGTGG - Intergenic
1118514240 14:66508669-66508691 TTCTCTGCGGCCTCGGGAGGAGG + Intronic
1126837067 15:52678721-52678743 TCCGCGGCCGGCTCCGGGGGAGG + Intronic
1129456336 15:75677778-75677800 CTCGCCGCCTGCCCGGGACGTGG - Exonic
1132663483 16:1071605-1071627 ATGGCCGCAGGCTGGGGAGGAGG + Intergenic
1133156807 16:3881220-3881242 TTCGCCGCCGGCCAGGGAAGTGG + Intergenic
1134039989 16:11060967-11060989 GTTGCCGCTGACTCGGGAGGAGG + Exonic
1136913911 16:34163613-34163635 TTCGCCGCCGCCCCTGGTGGCGG + Intergenic
1140506985 16:75479715-75479737 CTCGCCGCCTGCTGGGGACGAGG + Exonic
1140514149 16:75530205-75530227 CTCGCCGCCGGCTGGGGATGAGG + Exonic
1142367157 16:89656828-89656850 TTTCCCGCCAGCTCGGTAGGGGG - Intronic
1144565075 17:16353217-16353239 GTCGCCGCGGGCCCAGGAGGAGG - Exonic
1149997282 17:61411842-61411864 TTCGCGGTCAGCTGGGGAGGCGG - Exonic
1152069574 17:78128179-78128201 CTCGCTGCCGGCTGGGGTGGGGG - Intronic
1158601946 18:58863518-58863540 CTCGCCGCCGGGCCGGGCGGCGG - Intronic
1163365108 19:16871457-16871479 TTCACTCCCCGCTCGGGAGGGGG + Intronic
1167112696 19:47471564-47471586 TTCTCGGGCGGCTGGGGAGGGGG - Intronic
928022465 2:27715530-27715552 CGCGCCGCCGGGCCGGGAGGGGG + Intronic
932337360 2:70938726-70938748 TTGGCTCCCGGCTGGGGAGGAGG + Intronic
936203118 2:110424968-110424990 GTCGCTGCCGGCTGGGGTGGTGG - Intronic
938909873 2:135876208-135876230 GACGCCGCAGGCTCCGGAGGCGG + Intronic
943645906 2:190408112-190408134 TCCGCCGCCGCCGCAGGAGGCGG + Intergenic
1170554769 20:17506099-17506121 TTCGCTGCCGGCTCCGAACGTGG + Intronic
1171768178 20:29301368-29301390 TTCTCCCCCGACTCGGAAGGGGG + Intergenic
1175358514 20:58389124-58389146 TGCGCCGCCGGCTCCAGGGGCGG - Exonic
1175448489 20:59042811-59042833 TGCGCCGCCGGCTGGGGTGCTGG - Exonic
1177894783 21:26845541-26845563 CGCGCTGCGGGCTCGGGAGGGGG + Intergenic
1181531894 22:23521798-23521820 CCCGCCGCCTGCTCGGGTGGTGG - Intergenic
1184680886 22:46071608-46071630 TTCGCCGCCGGATCGGAGCGGGG - Intronic
950463056 3:13136670-13136692 TTCTCTGCTGCCTCGGGAGGTGG - Intergenic
950683967 3:14603154-14603176 TCAGCCGCGGGCTCGGGAGCCGG - Intergenic
968362264 3:198155623-198155645 TTCTCCGCCGGCTCTGGCTGCGG + Intergenic
968445645 4:650822-650844 TTCGCTGCCGGCTCGGGCTCAGG - Intronic
968642383 4:1721162-1721184 TTCTCGGCCGGCCCTGGAGGCGG + Exonic
972396517 4:38663728-38663750 TTCCCCCCGGGCTCGGGCGGCGG + Intergenic
973894239 4:55396166-55396188 TGCGCGGCCGGCCCGGCAGGCGG + Exonic
981070002 4:140524424-140524446 TTCGCGGGCGGCGCGCGAGGGGG + Intronic
995106356 5:108381424-108381446 CTCGCCGCCGCCGCGGGACGGGG - Exonic
1002888706 6:1316830-1316852 TTCCTCGCAGGCGCGGGAGGAGG + Intergenic
1005256115 6:24005140-24005162 TTCGCCTACTGCTCTGGAGGTGG + Intergenic
1007701906 6:43770751-43770773 TCCGCCGCCGGCCGGGGAGGAGG - Exonic
1021558591 7:21946054-21946076 TTCGCAGGCGGCGCGAGAGGGGG + Exonic
1023405826 7:39833322-39833344 TTCGGCGCCGGCTCGGCCTGGGG - Intergenic
1023955701 7:44885265-44885287 CTCGCCGCCGCCGCGGGACGCGG + Exonic
1035018546 7:155787357-155787379 TTAGCCGCGGGCTCAGGCGGGGG - Intergenic
1039996859 8:42541686-42541708 CACGCTGCCGGCTCCGGAGGCGG - Intronic
1042902960 8:73746727-73746749 TTCGCCGGCGGCGCGGAAGTCGG + Intronic
1047202897 8:122781536-122781558 TTCGCCGGTGTCTCCGGAGGGGG + Exonic
1048009222 8:130443186-130443208 CTCGCCTCCAGCTCGGGAGAGGG - Intronic
1054781995 9:69174201-69174223 GCCGCCGCCGCCGCGGGAGGAGG + Intronic
1061348092 9:130042881-130042903 TTCCCCGCGGCCTGGGGAGGGGG - Intronic
1190062224 X:47218932-47218954 GCCGCCGCCGGCTGAGGAGGAGG - Intronic
1196442354 X:115728417-115728439 TCCGCCGCGGGGTCGGGCGGTGG - Intergenic
1196443203 X:115732487-115732509 TCCGCCGCGGGGTCGGGCGGTGG + Intergenic
1196443861 X:115735455-115735477 TCCGCCGCGGGGTCGGGCGGTGG + Intergenic
1196445524 X:115844402-115844424 TCCGCCGCGGGGTCGGGCGGTGG + Intergenic
1196446195 X:115847383-115847405 TCCGCCGCGGGGTCGGGCGGTGG + Intergenic
1196446866 X:115850364-115850386 TCCGCCGCGGGGTCGGGCGGTGG + Intergenic
1196447534 X:115853347-115853369 TCCGCCGCGGGGTCGGGCGGTGG + Intergenic
1196448205 X:115856326-115856348 TCCGCCGCGGGGTCGGGCGGTGG + Intergenic
1196448874 X:115859317-115859339 TCCGCCGCGGGGTCGGGCGGTGG + Intergenic
1196449545 X:115862308-115862330 TCCGCCGCGGGGTCGGGCGGTGG + Intergenic
1196450214 X:115865291-115865313 TCCGCCGCGGGGTCGGGCGGTGG + Intergenic
1196450884 X:115868276-115868298 TCCGCCGCGGGGTCGGGCGGTGG + Intergenic
1196451555 X:115871255-115871277 TCCGCCGCGGGGTCGGGCGGTGG + Intergenic
1196452226 X:115874242-115874264 TCCGCCGCGGGGTCGGGCGGTGG + Intergenic
1196452896 X:115877211-115877233 TCCGCCGCGGGGTCGGGCGGTGG + Intergenic
1196453566 X:115880204-115880226 TCCGCCGCGGGGTCGGGCGGTGG + Intergenic
1196454235 X:115883213-115883235 TCCGCCGCGGGGTCGGGCGGTGG + Intergenic
1196455316 X:115888285-115888307 TCCGCCGCGGGGTCGGGCGGTGG + Intergenic