ID: 902170142

View in Genome Browser
Species Human (GRCh38)
Location 1:14603721-14603743
Sequence GAGGGTAAAGGGATGGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1594
Summary {0: 1, 1: 1, 2: 5, 3: 156, 4: 1431}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902170142_902170151 22 Left 902170142 1:14603721-14603743 CCTCTCTCCATCCCTTTACCCTC 0: 1
1: 1
2: 5
3: 156
4: 1431
Right 902170151 1:14603766-14603788 GCACTTTTTAGGAATCCTATAGG 0: 1
1: 0
2: 1
3: 12
4: 133
902170142_902170152 23 Left 902170142 1:14603721-14603743 CCTCTCTCCATCCCTTTACCCTC 0: 1
1: 1
2: 5
3: 156
4: 1431
Right 902170152 1:14603767-14603789 CACTTTTTAGGAATCCTATAGGG 0: 1
1: 0
2: 1
3: 8
4: 127
902170142_902170148 0 Left 902170142 1:14603721-14603743 CCTCTCTCCATCCCTTTACCCTC 0: 1
1: 1
2: 5
3: 156
4: 1431
Right 902170148 1:14603744-14603766 TTACTCCTCAAGAAGACTGTTGG 0: 1
1: 0
2: 0
3: 15
4: 150
902170142_902170150 11 Left 902170142 1:14603721-14603743 CCTCTCTCCATCCCTTTACCCTC 0: 1
1: 1
2: 5
3: 156
4: 1431
Right 902170150 1:14603755-14603777 GAAGACTGTTGGCACTTTTTAGG 0: 1
1: 0
2: 0
3: 14
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902170142 Original CRISPR GAGGGTAAAGGGATGGAGAG AGG (reversed) Intronic
900681761 1:3920390-3920412 GAGGGAAGAGGGAGGGAGGGAGG - Intergenic
900699292 1:4034155-4034177 GAGGGTGAAGCGCTGCAGAGAGG - Intergenic
900870918 1:5302175-5302197 AAGGATAAAGGAATGGGGAGAGG + Intergenic
900943117 1:5814110-5814132 GAGGGTGAAGGGGAGGGGAGAGG - Intergenic
900968810 1:5977888-5977910 GAGGGGAGGGGGAAGGAGAGGGG + Intronic
901419751 1:9142993-9143015 GAGGGAAGAAGGAAGGAGAGAGG - Intergenic
901483946 1:9545163-9545185 GAAGGTAGAGGAATGGGGAGGGG + Intronic
901672766 1:10866007-10866029 GAGGGGAGAGGAAAGGAGAGAGG + Intergenic
901841773 1:11958199-11958221 GAGGTTCATGGGATGGGGAGGGG - Intronic
901930831 1:12595484-12595506 GATGGGAAAGGGGTGGAAAGGGG + Intronic
902051639 1:13567927-13567949 GAGGGGAAAGAGAGGCAGAGGGG + Intergenic
902051649 1:13567971-13567993 GAGGGGAAAGAGAGGCAGAGGGG + Intergenic
902051659 1:13568015-13568037 GAGGGGAAAGAGAGGCAGAGGGG + Intergenic
902051669 1:13568059-13568081 GAGGGGAAAGAGAGGCAGAGGGG + Intergenic
902051679 1:13568103-13568125 GAGGGGAAAGAGAGGCAGAGGGG + Intergenic
902170142 1:14603721-14603743 GAGGGTAAAGGGATGGAGAGAGG - Intronic
902216138 1:14935665-14935687 GAGGGGAGAGGGAGGGAGAGAGG - Intronic
902395943 1:16132579-16132601 GTGGGTACAGGTATGGGGAGAGG + Intronic
903034608 1:20485862-20485884 GAGGGGGAGGGGAGGGAGAGAGG + Exonic
903396183 1:23003475-23003497 GAGGGTAGAGACACGGAGAGAGG + Intergenic
903573584 1:24323776-24323798 GAGGCAAAAGGAATAGAGAGGGG - Intronic
903661797 1:24983019-24983041 GCAGGGAAAGGGATGGAGTGAGG + Intergenic
903670250 1:25031182-25031204 GAGGATGAAGGGATGGAGGCTGG + Intergenic
903691123 1:25174395-25174417 GAGGCCAAGGGGATGGGGAGTGG + Intergenic
904706565 1:32395201-32395223 GAGGGAAAAGAGATGAAGGGGGG - Intergenic
904948070 1:34213910-34213932 GAAGAGAAAGGGAGGGAGAGAGG - Intronic
904986858 1:34558213-34558235 GAGGGTGAAGGGTAGGAGAAGGG - Intergenic
905005985 1:34710890-34710912 GTTGGTTAAGGGAAGGAGAGAGG - Intergenic
905514959 1:38555850-38555872 GAGGGAAAGGGGAGGGAAAGAGG + Intergenic
905751369 1:40467570-40467592 AAGGGTAATGGGATGAAGAAAGG - Intergenic
906359354 1:45139440-45139462 GAGGGAGAGGGGAGGGAGAGAGG - Intronic
906501526 1:46344628-46344650 GAGGGAAAAGTAGTGGAGAGTGG - Intronic
906507693 1:46392654-46392676 TAGGGGAAGGGGAAGGAGAGGGG - Intergenic
906568368 1:46816260-46816282 GAGGGCAGAGGGAAGGAGTGAGG + Intronic
906904147 1:49869824-49869846 GGGGATAAGGGGATGAAGAGAGG + Intronic
906911792 1:49960014-49960036 GAGGGTGAAGGGTGGGAGCGGGG + Intronic
907114426 1:51956535-51956557 GAGGAGAAAAGAATGGAGAGGGG - Intronic
907178916 1:52553100-52553122 GGGGGGGAAGGGATGGGGAGGGG + Intronic
907501138 1:54881973-54881995 GAGGGTGGAGGGAGGGAGAAGGG + Intronic
907889821 1:58626054-58626076 TTGGGTAAAGGAATAGAGAGTGG - Intergenic
907960134 1:59271473-59271495 GAGGGTAAAGGGTGGGAGGAGGG + Intergenic
908262568 1:62350139-62350161 GAGGGGAAAGGGAAGGGGAAAGG + Intergenic
908481485 1:64544516-64544538 GTGGGTCAGTGGATGGAGAGAGG + Intronic
908916734 1:69136248-69136270 GAGGAGAAAGGGAAGGAGGGAGG + Intergenic
909030171 1:70530104-70530126 GATGATAAAAGGCTGGAGAGCGG - Intergenic
909312914 1:74175896-74175918 GAGTGTAAAGGGATGTTAAGAGG - Intronic
909314143 1:74194913-74194935 GAGGGGAAAGGGATAGGGAGAGG - Intronic
909889035 1:80979958-80979980 AAGAGTAAAGGGAGGTAGAGGGG + Intergenic
909906243 1:81199269-81199291 GAGGTGAATGGGATGGGGAGAGG - Intergenic
910288854 1:85581084-85581106 CAGGGGAAGGGGCTGGAGAGCGG - Intronic
910359837 1:86404542-86404564 GAGGGTGGAGGGGTGGGGAGGGG + Intergenic
910416752 1:87009234-87009256 CAGTTTAAAGGGATGGAGAAAGG - Intronic
910748721 1:90603412-90603434 AAGGGTGAAGGGCTGGAAAGAGG + Intergenic
911087011 1:93987532-93987554 GTAGGGAAAGGGAGGGAGAGGGG - Intergenic
911151818 1:94603676-94603698 AAGGCTAAAGGGATGGAGAATGG + Intergenic
911332574 1:96542265-96542287 GAGGAAAAAGGGATGGAGAAGGG - Intergenic
911398096 1:97337442-97337464 CAGGGCAGAAGGATGGAGAGTGG - Intronic
911620941 1:100065821-100065843 AAGGGAAAAGGAATGGAGAAAGG - Intronic
912418680 1:109529082-109529104 GAGGGTGCAGGGCTGGAGAGTGG + Intergenic
912868573 1:113282034-113282056 TAGGGAAAAAGGATGGAGAGAGG + Intergenic
913533437 1:119749375-119749397 GGGGGGAAAGGGAGAGAGAGAGG - Intronic
913562982 1:120041904-120041926 GAAGGGAAAGGGAAAGAGAGAGG + Intronic
913635141 1:120751685-120751707 GAAGGGAAAGGGAAAGAGAGAGG - Intergenic
914283579 1:146201271-146201293 GAAGGGAAAGGGAAAGAGAGAGG + Intronic
914422494 1:147541936-147541958 GAGGGAAAAGAGAGAGAGAGAGG + Intronic
914544610 1:148652007-148652029 GAAGGGAAAGGGAAAGAGAGAGG + Intronic
914622017 1:149419007-149419029 GAAGGGAAAGGGAAAGAGAGAGG - Intergenic
914869654 1:151462207-151462229 AAGGGTAAAGGGCAGGATAGGGG + Intergenic
914906255 1:151747832-151747854 GAGGGAAAAGGGACAAAGAGAGG - Intergenic
915213223 1:154325130-154325152 GAGGGTGAAGGAACGGAGGGCGG + Exonic
915653139 1:157334324-157334346 GAGGTTAAGGGGATGCTGAGAGG - Intergenic
915684423 1:157617165-157617187 GAGGTTAAGGGGATGCTGAGAGG + Intergenic
916055665 1:161067674-161067696 GGGGGCAAAGAGCTGGAGAGAGG + Intronic
916285775 1:163103406-163103428 GAGGGTAGAGGGTGGGAGAAGGG - Intergenic
916412351 1:164559055-164559077 GGGGGCAAAGGGAAGGGGAGGGG - Intronic
916691086 1:167190622-167190644 AATGGTAAAAGGAAGGAGAGGGG - Intergenic
916999306 1:170339021-170339043 GGGGATAAAGGGAGGCAGAGAGG + Intergenic
917051492 1:170929784-170929806 GAGGGTACTAGGCTGGAGAGAGG + Intergenic
917090950 1:171352632-171352654 GTAAGTAAAGGGATGGGGAGAGG - Intergenic
917142883 1:171855024-171855046 GAGGGTGAAGGGTGGGAGAAGGG - Intronic
917268121 1:173243351-173243373 GAGGGTAAGGGGCTGGAAAATGG - Intergenic
917535721 1:175873030-175873052 TATGGAAATGGGATGGAGAGAGG - Intergenic
917611737 1:176695711-176695733 GGAGATAAAGGGATGGAGATGGG - Intronic
917675091 1:177311329-177311351 GAGGGAAAGGGGCTGGGGAGGGG + Intergenic
917762612 1:178179495-178179517 GAGGGTAAGAGAAAGGAGAGAGG + Intronic
918294136 1:183139455-183139477 GAGTGTAAAAGGAGGGAGAAAGG - Intronic
918462033 1:184786768-184786790 GAGGTTCAAGGGATGGGAAGAGG - Intergenic
918586375 1:186193302-186193324 GAGGGAGAAGGGAAGGAGAAAGG + Intergenic
918660465 1:187081781-187081803 GAAGGAAAAGGGAGGGAGGGAGG - Intergenic
918760696 1:188401785-188401807 GTGGGGAAAGGGAGGGTGAGGGG + Intergenic
918952754 1:191160701-191160723 GAGGGGAGAGGGATGGGGAGGGG + Intergenic
919805039 1:201376493-201376515 GGGGGTAAGGGGATGGGGAGAGG + Intronic
920057488 1:203203045-203203067 GAGGGGATAAGGATGGAGAGAGG - Intergenic
920340891 1:205274493-205274515 GAGGAAAAAGGGAGGGAGGGTGG + Intergenic
920780904 1:208990181-208990203 GAGGGGAAACAGAGGGAGAGGGG + Intergenic
921222530 1:212983392-212983414 GAGGGCAAAGAGAGGGAGAGAGG + Intronic
921236648 1:213138501-213138523 GAGGGTAAAGGGTGGGAGGAGGG - Intronic
921370705 1:214419938-214419960 GAGGATAGAGGGATGGAGGGAGG - Intronic
921517386 1:216112604-216112626 GAGGGTGAAGGGAGGCAGAAGGG - Intronic
921573292 1:216803979-216804001 GAGGGCAGATGGAGGGAGAGAGG - Intronic
921671350 1:217927265-217927287 GAGAGCAAAGAGAAGGAGAGTGG + Intergenic
921790407 1:219283476-219283498 GTGTGGAAAGGGATGGAAAGTGG + Intergenic
921942400 1:220855631-220855653 AAGGGTAATGGGAGGGTGAGTGG - Intergenic
922096591 1:222448030-222448052 GAGGGGAAAAGGCTGGAGGGAGG - Intergenic
922149837 1:222990172-222990194 GAGAGTAAAGGTGTGGAGAAAGG + Intronic
922171463 1:223159184-223159206 GAGGGGCAAGGGAAGGAGGGAGG + Intergenic
922360697 1:224818891-224818913 GAAGAGAAAGGGATGGAAAGAGG - Intergenic
922381416 1:225032215-225032237 GAAGGTAGAAGGAGGGAGAGGGG - Intronic
922398915 1:225230586-225230608 GTGGGTAATGGGAGTGAGAGGGG + Intronic
922497027 1:226065297-226065319 GAGGGTGTAGGGAAGGAGAGTGG + Intronic
922790924 1:228310582-228310604 GATAGTAAATGGATGGATAGCGG - Intronic
922874073 1:228926250-228926272 GAGGGAAAAGGCATGGTGAAAGG + Intergenic
922909680 1:229205087-229205109 GAGGGGAAAGGCAGAGAGAGTGG - Intergenic
923052075 1:230396114-230396136 GGGGGTAAAGGGGAGGAGAGTGG - Intronic
923433936 1:233950602-233950624 AAGGGTGGAGGGATGGAGGGAGG - Intronic
923534456 1:234838224-234838246 GAGGGGAATGGGAGGGGGAGGGG + Intergenic
923589050 1:235302233-235302255 AAGGGGAAAGAGATGGGGAGGGG + Intronic
923784103 1:237051230-237051252 GAGGGGAAGGGGAGGGAAAGGGG - Intronic
924246884 1:242093821-242093843 GGGGGGAAAATGATGGAGAGAGG + Intronic
924274442 1:242371503-242371525 GGGGGATAAGGGATGGAGAAAGG - Intronic
924293975 1:242566898-242566920 GAGGGTTAAAAGAGGGAGAGGGG - Intergenic
924494697 1:244575738-244575760 TAGGGGAAAGGGAAGGAGAGGGG - Intronic
924726589 1:246677021-246677043 GAGGGGCAAAGGATGGAGGGAGG + Intergenic
924816944 1:247451101-247451123 GTAGGTGAAGGGATTGAGAGTGG + Exonic
1062894850 10:1095364-1095386 GAGGTAACAGGCATGGAGAGAGG + Intronic
1063662116 10:8042140-8042162 GAGGGTAAATGGAGCCAGAGAGG + Intergenic
1063975323 10:11410572-11410594 GAGGTAAAAGGCAGGGAGAGAGG + Intergenic
1064075246 10:12263773-12263795 GAGGGGAGAGGGAGGGAGAGGGG - Intergenic
1064115860 10:12576977-12576999 CTGGGGAAAGGGGTGGAGAGAGG + Intronic
1064322382 10:14317708-14317730 GAGGGGAGAGGGAAGGAGAAAGG + Intronic
1064910989 10:20401438-20401460 GAGAGAAACGGGGTGGAGAGAGG + Intergenic
1065169361 10:23011032-23011054 GAAAGGAAAGGGAAGGAGAGAGG - Intronic
1065310331 10:24409740-24409762 CAGGGGAAAGGGTGGGAGAGGGG - Intronic
1065638289 10:27753194-27753216 GAGGGAAAAGAGAGGGAGAAAGG - Intergenic
1065638307 10:27753272-27753294 GAGGGAAAAGAGAGGGAGAAAGG - Intergenic
1065705315 10:28466855-28466877 GAGAGGACAGGGAAGGAGAGAGG + Intergenic
1066122546 10:32303625-32303647 GATGGTCAGGGGATGGGGAGAGG + Intronic
1066334664 10:34463301-34463323 GAGGGGAAAGGGAAGGGGAAAGG + Intronic
1066413358 10:35195442-35195464 GAGGATAGAGGGAGGAAGAGAGG - Intronic
1066476694 10:35753838-35753860 GAGGGTGGAGGGTGGGAGAGGGG - Intergenic
1066656573 10:37703380-37703402 GTAGGCACAGGGATGGAGAGAGG + Intergenic
1067041084 10:42953588-42953610 GTAGGCACAGGGATGGAGAGAGG + Intergenic
1067148584 10:43711317-43711339 GAGGCTAAAGGGATAGGGGGTGG + Intergenic
1067296041 10:44975563-44975585 GAGTGGAAAGGGAGGTAGAGAGG - Intronic
1067922677 10:50476302-50476324 GAGGGGAGGGGGAGGGAGAGAGG + Intronic
1068237152 10:54252132-54252154 GAGGGAAAAGAGATGTAGACAGG - Intronic
1068411944 10:56667604-56667626 AAGGGGAAAGGGAGGGGGAGGGG - Intergenic
1068800577 10:61135732-61135754 GAGGGTAAATGGCTGGAGTAAGG - Intergenic
1068848231 10:61705083-61705105 GAGACTAAAGTTATGGAGAGAGG + Intronic
1069423753 10:68271494-68271516 CAGGATACAGGGATGGACAGCGG + Intergenic
1070504792 10:77103772-77103794 GAGGGGAAAAAGATGGAGAGGGG - Intronic
1070523354 10:77274316-77274338 GAAGGTTTAGGGAAGGAGAGGGG - Intronic
1070543199 10:77432120-77432142 AAGGGGAAAGGAAAGGAGAGAGG - Intronic
1071022625 10:81076570-81076592 GAGGGTGGAGGGTGGGAGAGGGG - Intergenic
1071163195 10:82776521-82776543 GAGGGTAAAGAGATGGAAAAAGG - Intronic
1071187071 10:83058334-83058356 GAGGGTAGAGGCACGGGGAGGGG - Intergenic
1071441591 10:85702758-85702780 GAGGATAAACGGAGGCAGAGAGG + Intronic
1071617709 10:87091829-87091851 GTTGGTAAAAGGGTGGAGAGAGG + Intronic
1071736712 10:88309128-88309150 GAGGGTATAGGGTGGGAGAAGGG + Intronic
1071878025 10:89863578-89863600 GAGGGGAAAGGGGTGGGAAGTGG + Intergenic
1072286358 10:93919721-93919743 GAGGGTAGAGGGTAGGAGAAGGG + Intronic
1072309594 10:94141597-94141619 GAAGGCAAAGGGAAGGAGAAAGG + Intronic
1072926939 10:99624033-99624055 GAGGGAGGAGGGAGGGAGAGAGG - Intergenic
1073215848 10:101835671-101835693 GTGTGTAAAGGGGTGGGGAGAGG + Intronic
1073835442 10:107435834-107435856 GAGGGAAAGGGGAGAGAGAGAGG + Intergenic
1074002440 10:109386725-109386747 GAGGGGAGAGGGAGGGAGGGAGG + Intergenic
1074609167 10:115004530-115004552 GAGGGAGAAGGGAAGGGGAGGGG - Intergenic
1074827977 10:117228425-117228447 GAGGGAAAAGGGAGGAAGTGAGG - Intergenic
1074829452 10:117238674-117238696 AAGGGGAAAGGGAGGGAGGGGGG - Intergenic
1074935743 10:118179565-118179587 GAGGGGAGAGGGATGGATAGAGG + Intergenic
1075667142 10:124239564-124239586 GAGGGGGAAGGGAGGGAGAGAGG + Intergenic
1075968173 10:126630805-126630827 GATGGTAAGGGAATGGAGGGTGG - Intronic
1075987893 10:126803809-126803831 GAGGGGAAAGGGAAGGAGGCAGG - Intergenic
1076232409 10:128832548-128832570 GAAGGGAAAGGGAAGGGGAGGGG + Intergenic
1076595926 10:131623931-131623953 TGGGGGAAAGAGATGGAGAGAGG + Intergenic
1076809496 10:132879183-132879205 GAGGGTGCAGGAATGAAGAGGGG + Intronic
1076989913 11:267481-267503 GAGGGGAGGGGGAGGGAGAGGGG + Intergenic
1077103119 11:830840-830862 GAGGGTGGAAGGATGGAGACCGG - Intronic
1077135419 11:995735-995757 GAGGGGAGAGGGAGGAAGAGGGG - Intronic
1077287757 11:1775358-1775380 GATGGAGAGGGGATGGAGAGGGG + Intergenic
1077287767 11:1775391-1775413 GATGGAGAGGGGATGGAGAGGGG + Intergenic
1077287783 11:1775446-1775468 GATGGAGAGGGGATGGAGAGGGG + Intergenic
1077287792 11:1775469-1775491 GATGGAGAGGGGATGGAGAGGGG + Intergenic
1077287796 11:1775480-1775502 GATGGAGAGGGGATGGAGAGGGG + Intergenic
1077287800 11:1775491-1775513 GATGGAGAGGGGATGGAGAGGGG + Intergenic
1077287810 11:1775524-1775546 GATGGAGAGGGGATGGAGAGGGG + Intergenic
1077287828 11:1775580-1775602 GATGGAGAGGGGATGGAGAGGGG + Intergenic
1077287838 11:1775613-1775635 GATGGAGAGGGGATGGAGAGGGG + Intergenic
1077287854 11:1775668-1775690 GATGGAGAGGGGATGGAGAGGGG + Intergenic
1077287869 11:1775713-1775735 GATGGAGAGGGGATGGAGAGGGG + Intergenic
1077287888 11:1775758-1775780 GATGGAGAGGGGATGGAGAGGGG + Intergenic
1077287892 11:1775769-1775791 GATGGAGAGGGGATGGAGAGGGG + Intergenic
1077287896 11:1775780-1775802 GATGGAGAGGGGATGGAGAGGGG + Intergenic
1077287900 11:1775791-1775813 GATGGAGAGGGGATGGAGAGGGG + Intergenic
1077287909 11:1775814-1775836 GATGGAGAGGGGATGGAGAGGGG + Intergenic
1077287913 11:1775825-1775847 GATGGAGAGGGGATGGAGAGGGG + Intergenic
1077287917 11:1775836-1775858 GATGGAGAGGGGATGGAGAGGGG + Intergenic
1077287935 11:1775892-1775914 GATGGAGAGGGGATGGAGAGGGG + Intergenic
1077287939 11:1775903-1775925 GATGGAGAGGGGATGGAGAGGGG + Intergenic
1077287949 11:1775936-1775958 GATGGAGAGGGGATGGAGAGGGG + Intergenic
1077287958 11:1775959-1775981 GATGGAGAGGGGATGGAGAGGGG + Intergenic
1077287962 11:1775970-1775992 GATGGAGAGGGGATGGAGAGGGG + Intergenic
1077287966 11:1775981-1776003 GATGGAGAGGGGATGGAGAGGGG + Intergenic
1077287976 11:1776014-1776036 GATGGAGAGGGGATGGAGAGGGG + Intergenic
1077287980 11:1776025-1776047 GATGGAGAGGGGATGGAGAGGGG + Intergenic
1077287991 11:1776059-1776081 GATGGAGAGGGGATGGAGAGGGG + Intergenic
1077287995 11:1776070-1776092 GATGGAGAGGGGATGGAGAGGGG + Intergenic
1077287999 11:1776081-1776103 GATGGAGAGGGGATGGAGAGGGG + Intergenic
1077288009 11:1776114-1776136 GATGGAGAGGGGATGGAGAGGGG + Intergenic
1077288013 11:1776125-1776147 GATGGAGAGGGGATGGAGAGGGG + Intergenic
1077288024 11:1776159-1776181 GATGGAGAGGGGATGGAGAGGGG + Intergenic
1077288035 11:1776193-1776215 GATGGAGAGGGGATGGAGAGGGG + Intergenic
1077288039 11:1776204-1776226 GATGGAGAGGGGATGGAGAGGGG + Intergenic
1077288050 11:1776238-1776260 GATGGAGAGGGGATGGAGAGGGG + Intergenic
1077288054 11:1776249-1776271 GATGGAGAGGGGATGGAGAGGGG + Intergenic
1077288065 11:1776283-1776305 GATGGAGAGGGGATGGAGAGGGG + Intergenic
1077288069 11:1776294-1776316 GATGGAGAGGGGATGGAGAGGGG + Intergenic
1077346165 11:2056305-2056327 GAAGGAGAAGGTATGGAGAGAGG - Intergenic
1078100537 11:8327936-8327958 GTGGGGAAAGGGAAGGGGAGTGG + Intergenic
1078131451 11:8617518-8617540 GTGGGTAAAAGAAGGGAGAGAGG - Exonic
1078842812 11:15094649-15094671 GAGGGTAAAGGGTGGAAGAGGGG - Intergenic
1078903291 11:15661461-15661483 GAAAGTTAAGGGATAGAGAGGGG - Intergenic
1079189313 11:18264755-18264777 GAGGGGAGAGGGGAGGAGAGAGG + Intergenic
1079332442 11:19544989-19545011 CAGGGTAGAGAGGTGGAGAGTGG - Intronic
1079613085 11:22457291-22457313 GTGGGTAGAGGGTTGGAAAGTGG - Intergenic
1079789465 11:24717742-24717764 GAGGGTGAAGGGAGGGAGGAGGG - Intronic
1079934474 11:26600335-26600357 GAGGGGAGAGGAAAGGAGAGGGG - Intronic
1080157406 11:29127913-29127935 AAGGGGAAAGGGAAGGAGAAGGG + Intergenic
1080582005 11:33651839-33651861 GAGGGGAATGGGAGGGGGAGGGG - Intronic
1080862712 11:36163724-36163746 GAGGGAAAAGGGAGAGAGAAAGG + Intronic
1081394531 11:42569873-42569895 AAGGGTAAAGGGATGGAGAGTGG - Intergenic
1081489488 11:43556550-43556572 GAGGGTAGAGGGAGGGAGGGAGG - Intronic
1081541609 11:44038615-44038637 GAGGGTAGAGTGAGGGGGAGAGG + Intergenic
1081565341 11:44257437-44257459 GACAGAGAAGGGATGGAGAGGGG + Intergenic
1081626511 11:44659158-44659180 ATGGATAATGGGATGGAGAGAGG + Intergenic
1081953702 11:47070243-47070265 GTGGGTGGATGGATGGAGAGAGG + Intronic
1081962302 11:47147393-47147415 GAGGGCAGAGGGAGGGAAAGTGG + Intronic
1082132339 11:48506162-48506184 GAGGGGGAAGGGATGGGGAAGGG - Intergenic
1082132344 11:48506173-48506195 GAGGGGAAAGGGAGGGGGAAGGG - Intergenic
1082244467 11:49905275-49905297 GAGGGGAAAGGAAGGGAGAATGG + Intergenic
1082565807 11:54676793-54676815 GAGGGGAAAGGGAGGGGGAAGGG - Intergenic
1083087502 11:60165381-60165403 GATGGGGAAGGGAGGGAGAGGGG + Intergenic
1083162785 11:60865590-60865612 GAGGGTAAGAGGAAGGAGAAGGG - Intergenic
1083176249 11:60951929-60951951 GAGGGGAAAGGGAGGCGGAGGGG - Intronic
1083254313 11:61486879-61486901 GAGGCAGCAGGGATGGAGAGGGG - Intronic
1083264467 11:61540160-61540182 GAGGGGCACGGGCTGGAGAGTGG + Intronic
1083674570 11:64318307-64318329 GACGGTACAGTGAAGGAGAGTGG + Exonic
1083743381 11:64722695-64722717 TTGGGGGAAGGGATGGAGAGAGG - Intronic
1083760524 11:64814281-64814303 CAGGGTTGAGGGATGGATAGAGG - Intergenic
1083947506 11:65932470-65932492 GAGTATAAAGGGATCGAGGGTGG - Intergenic
1084006568 11:66326429-66326451 GAGGGTGGAGGGAGGGAGGGAGG + Intergenic
1084092707 11:66889141-66889163 CAGGGTGAAGGGAGGGAAAGTGG + Intronic
1084344868 11:68540041-68540063 GAGGGAAAATGGAAGGAGGGAGG + Intronic
1084568541 11:69945260-69945282 GAGGGGAAGGGAAGGGAGAGAGG + Intergenic
1084694853 11:70746976-70746998 GGGGGTGCAGGGATGGAGGGAGG - Intronic
1085177418 11:74502793-74502815 GAGGGTAATGCCATGGGGAGAGG - Intronic
1085273778 11:75285444-75285466 GAGGGTAGGGGGAGAGAGAGAGG - Intronic
1085426632 11:76410606-76410628 GATGGTGATGGGCTGGAGAGAGG + Intronic
1085458589 11:76679593-76679615 GATGGGAAAAGGATGGAGAAAGG + Intergenic
1085787598 11:79468762-79468784 GAGGGTGGAGGGAGGGAGGGAGG + Intergenic
1085937236 11:81162332-81162354 GATGGCAAAGAGAAGGAGAGTGG + Intergenic
1086122805 11:83317856-83317878 GAGGGGAGAGGGAGGGGGAGAGG + Intergenic
1086417889 11:86607357-86607379 GTGGGAAAAGGGAGGGAGAAAGG - Intronic
1087273535 11:96137916-96137938 GTGGGGAAAAGGATGGAAAGGGG - Intronic
1087673159 11:101129112-101129134 GAGGGAAAAGGGAAGGAGGAGGG + Exonic
1087777738 11:102272020-102272042 AAGGGTAAGGAGATGAAGAGTGG + Intergenic
1087958600 11:104320418-104320440 GAGGGTGGAGGGATGGTCAGAGG + Intergenic
1088367289 11:109052982-109053004 GAGGGTAAAGGGAGTGAGCCTGG + Intergenic
1088442428 11:109886209-109886231 GAGGGTAAAGGGTGGGAGGAGGG + Intergenic
1088684801 11:112275580-112275602 GAGGGGAAAAGGAAGGAAAGGGG + Intergenic
1088736155 11:112729301-112729323 GAGGGGAAAGGGAGGCAGGGAGG + Intergenic
1088929437 11:114335592-114335614 GAAAGTAAATGGATGGAGAAAGG + Intergenic
1089190896 11:116652552-116652574 GAAGGTAAAGGGGTGGGAAGTGG - Intergenic
1089286981 11:117413775-117413797 GGGGGTGCAGGGATGGAGTGTGG - Intergenic
1089291289 11:117439214-117439236 GTGGGGACAGGGATGGAGAAAGG - Intronic
1089384894 11:118060947-118060969 GAGGTCACAGGGCTGGAGAGGGG - Intergenic
1089430153 11:118416882-118416904 GAGGGTAAAGGGAAGCAGTTTGG + Intronic
1089455351 11:118622501-118622523 GAGGGTGAAGGGCTGAGGAGGGG + Intronic
1089969251 11:122679179-122679201 GAGGGTGAAGGGGTGGGGCGAGG + Intronic
1090105737 11:123852182-123852204 CAGAGTAAAGGCATTGAGAGTGG - Intergenic
1090144041 11:124299955-124299977 GTGTGTAAAGGGATCGACAGGGG - Intergenic
1090172640 11:124618160-124618182 GAAGCTGGAGGGATGGAGAGTGG + Intronic
1090744199 11:129693663-129693685 GAGGGGAAAGGGAAGGGAAGGGG + Intergenic
1091070616 11:132559167-132559189 GAGGGGAAAGAGAGGGAGAGAGG + Intronic
1091301086 11:134508698-134508720 GAGGGTGAAGGGACGGGGAATGG + Intergenic
1091400443 12:177736-177758 CTGGGGACAGGGATGGAGAGGGG - Exonic
1091916317 12:4273620-4273642 GAGGGGAAAAGGAGGGAGGGAGG + Intergenic
1091990133 12:4948429-4948451 GAGGGAAAAGGGAGAGAGAGAGG - Intergenic
1092367972 12:7892769-7892791 AAGAGAAAAGGGAAGGAGAGAGG + Intergenic
1092505546 12:9095421-9095443 GAGGGTAATGGGATATAAAGAGG - Intronic
1092698578 12:11201749-11201771 GAGGGTGGAGGGAGGGAGAGAGG + Intergenic
1092850563 12:12622535-12622557 GAGGGGATAGGGGTTGAGAGAGG + Intronic
1093017644 12:14170961-14170983 GAGGGGAAGGGGAAGGAGAAGGG + Intergenic
1093052806 12:14522148-14522170 GAGGGAGAAGAGATGGAGAAGGG + Intronic
1093092932 12:14941663-14941685 GAGGGGTAAGGGAGGGAGTGGGG + Intergenic
1093233482 12:16577481-16577503 GAGGGTAGAAGGAGGGAGTGGGG - Intronic
1093626617 12:21356497-21356519 GAGAGAAAAAGGAAGGAGAGAGG + Intronic
1094691315 12:32772067-32772089 GAGGGGAAAGGGAAAGAGAAAGG + Intergenic
1094773182 12:33689994-33690016 GAGGGTAAAGGGTGGGAGAAGGG + Intergenic
1095692549 12:45106763-45106785 GAGTGTGGAGGGAAGGAGAGAGG - Intergenic
1095962755 12:47845712-47845734 GAGGCTCAAGGAATGGAGATGGG - Intronic
1096145910 12:49278543-49278565 GAGGGTGAAGGGAGAGAGAGTGG - Intergenic
1096528394 12:52228093-52228115 GAGGGGGAAGGGAGGGGGAGGGG - Intergenic
1096899877 12:54865977-54865999 GTGGGTTTAGGGATGCAGAGAGG + Intergenic
1097141111 12:56903046-56903068 GGGGGTCAAGGGAAGGAGGGTGG + Intergenic
1097244376 12:57599031-57599053 GAGGGGGAAGGAATGGGGAGAGG - Intronic
1097334815 12:58370272-58370294 GTGAGTAAGGGGATGGAGACAGG + Intergenic
1097377571 12:58858265-58858287 GAGGGAAGAGGGAGAGAGAGAGG - Intergenic
1097751699 12:63361918-63361940 GAGGGGAAAGGGAGGGAGGGAGG - Intergenic
1097879705 12:64675724-64675746 GAGGATTAGGGGATGGGGAGAGG + Intronic
1098082209 12:66799545-66799567 GAGGGGAAAAGGAAGGAGAGAGG - Intronic
1099144588 12:79024229-79024251 CTGGGTAATGGGATTGAGAGAGG + Intronic
1099243486 12:80166175-80166197 GAGGAAGAAGGGAGGGAGAGAGG - Intergenic
1099587794 12:84543835-84543857 GAAAGTAAAGGGATGGAAAAAGG - Intergenic
1099767454 12:87006282-87006304 CAGAGTAAAGGGATGGAGAAAGG - Intergenic
1099844205 12:88008207-88008229 GAGGGTAGAGGGTTGGAGGAGGG - Intronic
1099932221 12:89087679-89087701 AAGGGTAAGGGCAAGGAGAGAGG - Intergenic
1100255530 12:92879546-92879568 GAGGGGAAAAGAAGGGAGAGAGG + Intronic
1100319365 12:93475480-93475502 CATGGTAAAGGCATGGAGATAGG + Intronic
1100563102 12:95768800-95768822 GTAGCTACAGGGATGGAGAGAGG + Intronic
1100569802 12:95837150-95837172 GAGGGATGAGGGAGGGAGAGAGG + Intergenic
1100569877 12:95837496-95837518 GAGGGAAGAGAGATGGAGAGAGG + Intergenic
1100580778 12:95938431-95938453 AAGGATAAAGGGAATGAGAGTGG - Intronic
1100593384 12:96050543-96050565 AAGGGGAAAGGGAAGGAGGGAGG + Intergenic
1100643249 12:96503008-96503030 GAAGGGAGAGGGAGGGAGAGAGG - Intronic
1100748064 12:97667311-97667333 GAGGGAAGAGGGAGGGAGGGAGG + Intergenic
1100782764 12:98046997-98047019 AAGGGGAGAGAGATGGAGAGAGG + Intergenic
1100860381 12:98799529-98799551 GAGGGTGGGGGGAGGGAGAGAGG + Intronic
1101580552 12:106037908-106037930 GAGGAGAAAGAGAAGGAGAGAGG - Intergenic
1101731360 12:107429025-107429047 CAGGGGAAAGAGAGGGAGAGAGG + Intronic
1101759104 12:107644720-107644742 GAGGGTAAAGGGTGGGAGGAGGG - Intronic
1101807408 12:108076421-108076443 AAGGGCAAAGGTATGGAGGGAGG - Intergenic
1102325254 12:111975895-111975917 GATGGTAAGGTGTTGGAGAGGGG - Intronic
1102457966 12:113082474-113082496 GAGGGGAAAGGGATGGAGGTGGG + Intronic
1102552507 12:113702094-113702116 GAGAGAAAAGGGAAGGAGAAAGG - Intergenic
1102557250 12:113735347-113735369 GAGGATGTGGGGATGGAGAGAGG - Intergenic
1102662190 12:114538912-114538934 GAGGAGAAAGGAACGGAGAGTGG - Intergenic
1102665538 12:114569382-114569404 GAGGAGAAAGGAATGGAGAGTGG + Intergenic
1102744962 12:115242430-115242452 GAGGGTAAGAGGAGGGAGTGGGG - Intergenic
1102823284 12:115926222-115926244 TAGGGCTAAGGGATGGAGACAGG + Intergenic
1102920783 12:116789776-116789798 ATGGGTAAATGGAAGGAGAGTGG + Intronic
1102920788 12:116789799-116789821 ATGGGTAAATGGAAGGAGAGTGG + Intronic
1102984072 12:117264619-117264641 GGGGGGAAAGGGAGAGAGAGAGG - Intronic
1103018276 12:117513099-117513121 GAGGGAAACGAGATGGAGGGAGG - Intronic
1103917823 12:124385052-124385074 GAGGAGGAAGGGAAGGAGAGAGG + Intronic
1104001717 12:124864242-124864264 GAGGGAAAAGGAAGGGTGAGGGG - Intronic
1104009603 12:124920574-124920596 GAGGGAAAGGGGAAGGGGAGGGG - Intergenic
1104034249 12:125087535-125087557 GAGGGGAAAGGGAGGGAGGTCGG - Intronic
1104426149 12:128679847-128679869 GAGGGTAATGGGACGAGGAGAGG + Intronic
1104648832 12:130516529-130516551 GAGAAAAAAGGGATGGAGGGAGG + Intronic
1104833060 12:131767832-131767854 GAGGGTGGAGGGAGGGAGGGAGG + Intronic
1104854087 12:131894241-131894263 GAGGGGGCAGGGAGGGAGAGAGG + Intergenic
1105209546 13:18249813-18249835 GAGGGTTAGGGGATAGAGATGGG - Intergenic
1105950744 13:25227729-25227751 GAGGGGAAAGGTTTGGAAAGCGG - Intergenic
1106098112 13:26668384-26668406 GAGGGTACAGAGGTGGGGAGAGG - Intronic
1106441199 13:29773308-29773330 GAGACTAAAGGCATGGAGCGGGG - Intronic
1106590483 13:31094350-31094372 GATGGTAAATGGTTGGACAGAGG - Intergenic
1106612660 13:31298587-31298609 GAGGGTAAAGGAATGAATAATGG - Intronic
1106671683 13:31912797-31912819 GAGGTCAAAAGGATTGAGAGAGG - Intergenic
1107002376 13:35564026-35564048 GAGGGTAGAGGGAAGGAGGAAGG - Intronic
1107047046 13:36004446-36004468 AAGGGTAAAGGGCTGGGGTGGGG + Intronic
1107205417 13:37779878-37779900 GTGGGTAGAGGGCTGGAGAAGGG - Intronic
1107230987 13:38110213-38110235 GAGGGTAAAGAGCGGGAGAAGGG + Intergenic
1107336550 13:39361913-39361935 GAGGGAAAAGGGCAGGAGGGAGG + Intronic
1107359631 13:39603901-39603923 GAAGGGAAAGGGAGGGAGGGAGG - Intergenic
1107650727 13:42542063-42542085 GAAGATAAAGAGAAGGAGAGAGG - Intergenic
1107770710 13:43786171-43786193 GGAGGAAAAGGGATGCAGAGCGG + Intronic
1107937992 13:45361306-45361328 GAGGGGACGGGGATGGGGAGGGG - Intergenic
1108391254 13:49950018-49950040 CAGGGGAAAGGGTGGGAGAGGGG + Intergenic
1108396630 13:49996892-49996914 GAGGGGAAAGGGAGGGGGAGGGG + Intronic
1108396643 13:49996915-49996937 GAGGGGAAAGGGAGGGGGAGGGG + Intronic
1108405468 13:50096499-50096521 AAAGGTGAAGGGAAGGAGAGAGG - Intronic
1108458444 13:50641013-50641035 GAGGGAGAAGGGAGGGAGATAGG - Intronic
1108841710 13:54625936-54625958 CAGGGTAAAGGGACAGAAAGGGG + Intergenic
1109273874 13:60283103-60283125 TAGGCTAGAGAGATGGAGAGAGG - Intergenic
1109374818 13:61478603-61478625 GAGGGTAAAGGGAGGGAGGAAGG - Intergenic
1110281402 13:73698193-73698215 GAGGGGAAAGGGAAGGAGGAGGG + Intronic
1111010241 13:82303358-82303380 GAGAGTGGAGGGAGGGAGAGGGG + Intergenic
1111230811 13:85341570-85341592 GAGGGGGAGGGGAGGGAGAGGGG + Intergenic
1111469490 13:88659690-88659712 GAGGGCAGAGGGAGGGAGGGAGG + Intergenic
1111777225 13:92679872-92679894 GAGGGTGGGGGGGTGGAGAGAGG - Intronic
1111860551 13:93699377-93699399 AAGGGTAAAGGGAAGTGGAGTGG + Intronic
1112007920 13:95270058-95270080 GAGGATAAAGGAAGGGAGGGAGG + Intronic
1112180423 13:97073549-97073571 TAGGGAAATGGGATGGAGAGAGG - Intergenic
1112521038 13:100095498-100095520 TAGGTTAATGGGATAGAGAGTGG + Intronic
1112532209 13:100216070-100216092 GAGGGGAAGGGGAAGGGGAGGGG - Intronic
1112532218 13:100216087-100216109 AAGGGAAAGGGGAAGGAGAGGGG - Intronic
1112566799 13:100558832-100558854 GGGGGAGAGGGGATGGAGAGAGG + Intronic
1112715067 13:102174772-102174794 GAGGGTGAGGGGAGGGGGAGTGG + Intronic
1112782695 13:102918575-102918597 GAGGGTAAAGGGTGGGAGGAGGG - Intergenic
1113235177 13:108264691-108264713 AAGGGTGGAGGGATGAAGAGAGG - Intronic
1113257964 13:108528571-108528593 GAGGGGAAAGGGGAGGGGAGGGG - Intergenic
1113357797 13:109600064-109600086 GATGGTGCAGGGATGGAGACGGG - Intergenic
1113375194 13:109758936-109758958 AAGGGGAAAGGGAAGGAGAAGGG + Intronic
1113651913 13:112039526-112039548 GCGGGTGAAGGGAGTGAGAGCGG + Intergenic
1113966339 13:114155648-114155670 GAGGATGAAGGGGTGGGGAGGGG + Intergenic
1114170029 14:20262884-20262906 AAGGGCAAAGGGAAGGAGGGAGG + Intronic
1114552617 14:23542069-23542091 GAGGAAGAAGGGAAGGAGAGAGG + Intronic
1114782287 14:25551193-25551215 GAGGGAATGGGGATAGAGAGGGG + Intergenic
1115123766 14:29969485-29969507 GGTGGTAAAGGGAATGAGAGAGG + Intronic
1115393505 14:32880035-32880057 GAAAGTAAAGGGAGGGAGAAAGG - Intergenic
1115401639 14:32968087-32968109 GAGGGGCAGGGGATGGGGAGAGG + Intronic
1115578591 14:34735983-34736005 GGGGGTAGAGGGCTGGTGAGGGG - Intergenic
1115762558 14:36589979-36590001 GATGGTAAAGGGAAGGCAAGTGG + Intergenic
1115859854 14:37672215-37672237 CTGGGTCAAGGGATGGAGGGAGG - Intronic
1116163073 14:41294466-41294488 GGGGGTAAAGGGTGGGAGAAGGG + Intergenic
1116290005 14:43022447-43022469 GAGAAGAAAGGGATGGAGGGAGG - Intergenic
1116510064 14:45733886-45733908 GAGGGTAGAGGGTGGGAGAAGGG + Intergenic
1117234630 14:53758488-53758510 GAGGGTGAAGGGTGGGAGAAGGG + Intergenic
1117766948 14:59093205-59093227 AAGTGCAAAGGGATGGAGGGTGG - Intergenic
1117877380 14:60268106-60268128 AAGGGTGAAGGAATGGGGAGGGG - Intronic
1118021790 14:61724392-61724414 GAGGGGGAAGGGAAGGAGTGCGG - Intronic
1118073401 14:62271128-62271150 GATGGAAAGAGGATGGAGAGAGG - Intergenic
1118073403 14:62271139-62271161 GAGGGTGAGAGGATGGAAAGAGG - Intergenic
1118171786 14:63395738-63395760 GAGGGAAAAGGGAGGAGGAGGGG + Intronic
1118659557 14:67993329-67993351 GAGTGTAGCGGGATGGAGGGAGG - Intronic
1118749185 14:68794214-68794236 GAAGGTAAAGAGGTGGAGGGAGG + Intronic
1119673857 14:76539222-76539244 GAGGGAAAAGGGAAGGGGAGGGG - Intergenic
1119847442 14:77840906-77840928 GAGGGAAGAGGGAGGGAGGGAGG + Intronic
1119926855 14:78502819-78502841 GAGGGTAAATGGATACAGAATGG + Intronic
1121023761 14:90599326-90599348 GAGGGGAGAGGGAAGGCGAGGGG - Intronic
1121524945 14:94613247-94613269 GAGGGGAGAGGGGTAGAGAGAGG - Intronic
1121586737 14:95067952-95067974 GAGGCTGGAAGGATGGAGAGTGG - Intergenic
1121640530 14:95481980-95482002 GAAGGGGAAGGGAGGGAGAGAGG - Intergenic
1122422613 14:101587045-101587067 GAAGGTGGGGGGATGGAGAGGGG + Intergenic
1122549641 14:102543142-102543164 GAGGGCAGAGGGTTGGGGAGAGG + Intergenic
1122791424 14:104185620-104185642 GGGAGTAAAGGGATGGGGTGGGG + Intergenic
1122791452 14:104185688-104185710 GAGGGTAGAGAGATGGGGTGGGG + Intergenic
1122794228 14:104197940-104197962 GTGGGTGAATGGAGGGAGAGAGG - Intergenic
1122921099 14:104880493-104880515 GAGGGTTAAGGGGTGCAGAGAGG - Intronic
1122958216 14:105082740-105082762 GTGGGTGAAGGGGTGGATAGAGG - Intergenic
1122958304 14:105083045-105083067 GTGGGTGGAGGGGTGGAGAGAGG - Intergenic
1122958521 14:105083811-105083833 GAGGGTGGAGGGGTGGATAGAGG - Intergenic
1123736384 15:23188225-23188247 GAGGGGGAAGGGAAGGGGAGAGG - Intergenic
1124287090 15:28411202-28411224 GAGGGGGAAGGGAAGGGGAGAGG - Intergenic
1124295611 15:28500427-28500449 GAGGGGGAAGGGAAGGGGAGAGG + Intergenic
1124330848 15:28813759-28813781 AAGGGGGAAGGGAAGGAGAGAGG - Intergenic
1124343414 15:28904583-28904605 GAGGGAAAAGGAAGGAAGAGGGG - Intronic
1124352419 15:28967417-28967439 AAAAATAAAGGGATGGAGAGAGG - Intronic
1124642902 15:31408355-31408377 GAGGGACAAGGGAGGGATAGGGG - Intronic
1125001940 15:34780295-34780317 GAAGGGAGAGGGAGGGAGAGAGG - Intergenic
1125029462 15:35061733-35061755 GTGGGTAGGGGGTTGGAGAGTGG - Intergenic
1125202084 15:37108966-37108988 GAGGGGAAAGGGATAGAAAGCGG + Intergenic
1125228478 15:37424544-37424566 CAGGGGAAAGGGCAGGAGAGGGG - Intergenic
1125465880 15:39952034-39952056 GAAGATGAAGGGATGGGGAGGGG - Intronic
1125484900 15:40105135-40105157 GAGGGTAAAGGCTAGGAGCGTGG - Intronic
1125485921 15:40110740-40110762 GAGGGAAAAGGGAAAGAGTGGGG + Intergenic
1125701484 15:41689326-41689348 GAGGGAGAAGAGAGGGAGAGAGG - Intronic
1125793840 15:42389871-42389893 GGGTGGAAAGGGAAGGAGAGAGG - Intronic
1126181949 15:45793954-45793976 GGGGGCAAAGAGATGGAGATGGG + Intergenic
1126475842 15:49064118-49064140 GATGGAAAAGGGAAAGAGAGTGG - Intergenic
1126506497 15:49410149-49410171 AAGCCTAAAGGGCTGGAGAGTGG - Intronic
1127019124 15:54726294-54726316 GAGGGTAGAGGGAGAGAGGGGGG - Intergenic
1127052821 15:55102280-55102302 GAAGGGAGAGGGAAGGAGAGAGG + Intergenic
1127141714 15:55984754-55984776 GAGGATAAATGAATGGGGAGGGG - Intronic
1127326914 15:57904776-57904798 GAAGGGATGGGGATGGAGAGAGG + Intergenic
1127480615 15:59373480-59373502 GTGGGCAGAGGGAAGGAGAGAGG + Intronic
1127507638 15:59611032-59611054 GAGGGTGAGGGGAGGGGGAGGGG - Intronic
1127601738 15:60544305-60544327 CAGGGAAAAGGGATAGAAAGTGG + Intronic
1127646280 15:60962574-60962596 TAGGGTAAAGTGGAGGAGAGCGG - Intronic
1127867539 15:63043990-63044012 GGGGGTACAGGGAGGGAGGGGGG - Intronic
1128182827 15:65619933-65619955 GAGAGCAAATGGATGGAGAATGG - Intronic
1128462572 15:67882380-67882402 GAGGGGGAAGGGATGGAGGAAGG + Intergenic
1128594616 15:68932370-68932392 GGGGGAAAAGGGAAGGGGAGGGG - Intronic
1128793559 15:70449695-70449717 GTGGTTAGAGGGATGGAGGGAGG + Intergenic
1128793581 15:70449759-70449781 GTGGATACAGGGATGGAGGGAGG + Intergenic
1128794310 15:70453605-70453627 AAGGGGAAAGGGAAGGGGAGGGG - Intergenic
1128867417 15:71125107-71125129 AAGGGGAAAGGGAAGGAGAAAGG + Intronic
1129652262 15:77499471-77499493 CAGGGTAAAGAGCTGGGGAGAGG - Intergenic
1129893629 15:79088630-79088652 GTGGGTTGAGGGATGGAGGGGGG + Intronic
1130054624 15:80511820-80511842 GAGGGCAAAGGGAACAAGAGAGG + Intronic
1130197364 15:81793158-81793180 GAAGGGAAAGAGAGGGAGAGAGG + Intergenic
1130681576 15:86001581-86001603 GAGGGAAAAGGAAGGGAGGGAGG - Intergenic
1130931692 15:88433176-88433198 GAGGGTGAAGAGGTGAAGAGGGG - Intergenic
1131223920 15:90608144-90608166 GTGAGTAAGGGGATGGAGAGAGG + Intronic
1131276371 15:90984975-90984997 GTAGGAAAAGGGATGGGGAGTGG - Intronic
1131354746 15:91734937-91734959 GAGGGAAGAGGGAAGGAGATAGG + Intergenic
1131374860 15:91915217-91915239 AAGAGAAAAGTGATGGAGAGAGG - Intronic
1131807468 15:96137502-96137524 GAGGGTAAAGTGGTGGGCAGGGG + Intergenic
1131849182 15:96519767-96519789 GAGGGAGAAGAGATGGAGAATGG + Intergenic
1132007915 15:98247488-98247510 CAAGGTAAAGGGATGGAAAAAGG - Intergenic
1132161679 15:99548680-99548702 GATGGCAAAGGGAGGGAGAGTGG + Intergenic
1132327105 15:100981077-100981099 GGAGGTAAAGGCATAGAGAGAGG + Intronic
1132480774 16:165191-165213 GAGGGTGAAGGGCAGGGGAGGGG - Intronic
1132716411 16:1292417-1292439 GAGGGGAGAGGAAAGGAGAGGGG - Intergenic
1132716416 16:1292434-1292456 GAGGGGAGAGGAAAGGAGAGGGG - Intergenic
1132716429 16:1292479-1292501 GAGGGGAGAGGAAAGGAGAGGGG - Intergenic
1132716438 16:1292510-1292532 GAGGGGAGAGGAAAGGAGAGTGG - Intergenic
1132716441 16:1292527-1292549 GAGGGGAGAGGAAAGGAGAGGGG - Intergenic
1132716446 16:1292544-1292566 GAGGGGAGAGGAAAGGAGAGGGG - Intergenic
1133415760 16:5605753-5605775 TTGGGTACAGGAATGGAGAGTGG + Intergenic
1133485551 16:6215195-6215217 GAGGATAAGGAGAGGGAGAGGGG + Intronic
1133517270 16:6521503-6521525 GAGGGAAAAGCGAAGGGGAGGGG - Intronic
1133531185 16:6656930-6656952 GAGAGGAAAGGGGAGGAGAGGGG - Intronic
1133568820 16:7021997-7022019 GAAGGGAAGGGGAGGGAGAGGGG - Intronic
1133619670 16:7514301-7514323 TAGGGTAGGGGGATGAAGAGAGG - Intronic
1133685047 16:8158588-8158610 CAGAGTAAAGGAATGGAGATAGG - Intergenic
1134108324 16:11499328-11499350 GAGGGGGAAGGGAGGCAGAGGGG + Intronic
1134129410 16:11639101-11639123 GAGGTTAGAGGGATGGTTAGAGG + Intergenic
1134581862 16:15377645-15377667 GAGGGGAAGGGGAAGGGGAGGGG + Intronic
1135063502 16:19290330-19290352 GAGGGGAAGTGGAGGGAGAGAGG - Intronic
1135263345 16:21000121-21000143 GAGAGTAAAGGTATGTACAGTGG + Intronic
1135348286 16:21707773-21707795 AAGGGGAAAGGGATGGGGGGGGG - Intronic
1135543038 16:23346738-23346760 GAGGTTAAAGGATAGGAGAGGGG - Intronic
1135658475 16:24272987-24273009 GAGGGTAGAGGGTGGGAGAAGGG - Intronic
1135840801 16:25874382-25874404 GATGGTAAAGGGTTGGAGCCAGG + Intronic
1135852308 16:25975290-25975312 GAGGGGGAAGGGAGGGAGGGAGG + Intronic
1136151933 16:28356724-28356746 GAGGGGAAGGGGAGGGGGAGGGG + Intronic
1136151943 16:28356741-28356763 GAGGGGAAGGGGAGGGGGAGGGG + Intronic
1136151952 16:28356758-28356780 GAGGGGAAGGGGAAGGGGAGGGG + Intronic
1136168170 16:28470562-28470584 GAGGGGAAGGGGAGGGGGAGGGG + Intronic
1136168180 16:28470579-28470601 GAGGGGAAGGGGAGGGGGAGGGG + Intronic
1136168189 16:28470596-28470618 GAGGGGAAGGGGAAGGGGAGGGG + Intronic
1136186354 16:28591009-28591031 GAGGACAAAGGGAAGGAGTGGGG - Intronic
1136211126 16:28758524-28758546 GAGGGGAAGGGGAAGGGGAGGGG - Intronic
1136211135 16:28758541-28758563 GAGGGGAAGGGGAGGGGGAGGGG - Intronic
1136211145 16:28758558-28758580 GAGGGGAAGGGGAGGGGGAGGGG - Intronic
1136221593 16:28832916-28832938 CAGGGTAAAGGGGTTGGGAGTGG + Intronic
1136255840 16:29038465-29038487 GAGGGGAAGGGGAGGGGGAGGGG - Intergenic
1136255850 16:29038482-29038504 GAGGGGAAGGGGAGGGGGAGGGG - Intergenic
1136255866 16:29038510-29038532 GAGGGGAAGGGGAGGGGGAGGGG - Intergenic
1136309467 16:29397766-29397788 GAGGGGGAAGGGAAGGGGAGGGG + Intronic
1136627877 16:31472788-31472810 GGGGATGCAGGGATGGAGAGAGG + Intronic
1137328786 16:47469598-47469620 GAGGGGAGAGTGAGGGAGAGGGG + Intronic
1137361943 16:47826491-47826513 GAGAGGACAGGGGTGGAGAGGGG - Intergenic
1137386065 16:48043799-48043821 GTGGGTCAATGGATGGATAGTGG - Intergenic
1137451600 16:48579750-48579772 GAAGGTGAAGGGATGGAAAAAGG + Intronic
1137552177 16:49445266-49445288 GAGGGAAAAAAGAGGGAGAGAGG - Intergenic
1138099937 16:54244408-54244430 GAGAGTAGAGGGAGGCAGAGAGG - Intergenic
1138306578 16:55982161-55982183 GTGGGGGAAGGGATGGAGCGGGG - Intergenic
1138339876 16:56281607-56281629 GAGGAGGAAGGGAGGGAGAGAGG - Intronic
1138498399 16:57423067-57423089 GGAGGGGAAGGGATGGAGAGAGG + Intergenic
1138941265 16:61793402-61793424 GAGGGTAGAGGGAGGGAGGAGGG - Intronic
1139358282 16:66380451-66380473 GATGATAAAGGGATGGGTAGTGG + Intronic
1139469636 16:67171160-67171182 GTGGGCAAAGGAAGGGAGAGGGG - Exonic
1139601688 16:67991253-67991275 GGGGGTGCAGGGATGGAGGGTGG - Intronic
1139925334 16:70482907-70482929 GAGAGGAAAGGGATGGGGAGAGG - Intronic
1139925466 16:70483301-70483323 GAGAGGGAAGGGATGGGGAGAGG - Intronic
1140098612 16:71895710-71895732 GAGGAGAAAGGGAAGGATAGTGG + Intronic
1140233537 16:73138399-73138421 GAGGGTCAGGGGATGAAGACTGG + Intronic
1140655143 16:77132376-77132398 AAGGGGAAGGGGATGGGGAGGGG - Intergenic
1140781435 16:78300492-78300514 GAGGGGAGAGGGAAGGAGGGAGG - Intronic
1140923590 16:79562095-79562117 AAGGGAATAGGGATGGAAAGGGG - Intergenic
1140974284 16:80044288-80044310 AAGGGAAAAGGGGTGGGGAGAGG + Intergenic
1141340619 16:83200524-83200546 AAGGATACAGGGATGGATAGAGG - Intronic
1141344446 16:83232049-83232071 GAGGGTAGAGGGTAGGAGAAGGG + Intronic
1141432981 16:83980525-83980547 AGGGGTAAAGGGACAGAGAGTGG - Intronic
1141537753 16:84694660-84694682 GAGGGGGAAGGGAGGGAGGGGGG + Intergenic
1141619035 16:85227006-85227028 GTGGGTGAATGGATGGAAAGGGG - Intergenic
1141626699 16:85265202-85265224 GCGGGTAAAGGCCTGGAGTGTGG + Intergenic
1141714035 16:85716695-85716717 GAGGAGGAAGGGAGGGAGAGGGG + Intronic
1141756784 16:85996757-85996779 GAGGGAAAGAGGAAGGAGAGAGG + Intergenic
1141808494 16:86358021-86358043 GCGGGGAAAGGGGTGGAGGGGGG - Intergenic
1141932496 16:87215425-87215447 GAGGGAAGAGGAAGGGAGAGAGG + Intronic
1142049562 16:87949534-87949556 GAGGCCACAGGGCTGGAGAGAGG - Intronic
1142050336 16:87953931-87953953 GAGCGTTCAGGGAGGGAGAGGGG - Intronic
1143261925 17:5605920-5605942 GAAGATAAGGGGATGGAGAAAGG + Intronic
1143440390 17:6967664-6967686 AAGGATAGAGGGATAGAGAGAGG + Intronic
1143485512 17:7251668-7251690 AAGGGAAAAGGGAAGGGGAGGGG + Intronic
1143590485 17:7883470-7883492 GAGGGGAAAGCGAGGGAAAGGGG + Intronic
1143738977 17:8938534-8938556 GAGGATAAGGGGAGGGAGAATGG - Intronic
1144227964 17:13170168-13170190 GATGGTAAAGATGTGGAGAGAGG + Intergenic
1144777006 17:17789915-17789937 GAGGGAGAAGGGGTGGTGAGAGG - Intronic
1144817938 17:18049593-18049615 GAGGGTAGAGGGTAGGAGAAGGG - Intronic
1144860932 17:18301419-18301441 CAAGGTAAAGGGATAGAGAAAGG - Intronic
1144877681 17:18410982-18411004 TTGGGGAAAGAGATGGAGAGGGG - Intergenic
1145154550 17:20533421-20533443 TTGGGGAAAGAGATGGAGAGGGG + Intergenic
1145268221 17:21390551-21390573 GGGGGCACAGGGATGGGGAGGGG + Intronic
1146307836 17:31744146-31744168 GAGGGTGGAGGGAGGGAGGGAGG + Intergenic
1146422218 17:32698295-32698317 GAGGGAAGGGGGAGGGAGAGGGG - Intronic
1146430387 17:32787741-32787763 GAGGGGAAAGGGAGGGAGGTGGG - Intronic
1146638857 17:34525507-34525529 GGGGTTAAAGCCATGGAGAGGGG + Intergenic
1146953205 17:36920829-36920851 GAGGGTGGAGGGCTGGAGGGGGG + Intergenic
1147176584 17:38659544-38659566 GAGGAGGAAGGGATGGAGGGAGG + Intergenic
1147401213 17:40180985-40181007 GAGGGGAAAGGGGTGGTGAGAGG + Intronic
1147492525 17:40883442-40883464 GAGGATACAGGGATGGACAGAGG - Intronic
1147820613 17:43239451-43239473 GGGGGGAAAGAGAGGGAGAGAGG + Intergenic
1147826366 17:43272651-43272673 GGGGGGAAAGAGAGGGAGAGAGG + Intergenic
1147827255 17:43277504-43277526 GGGGGGAAAGAGAGGGAGAGAGG + Intergenic
1147839581 17:43361789-43361811 GAGGGGGAAGGGAGGGGGAGGGG - Intergenic
1147845950 17:43403971-43403993 GAGGGAAGAGGGAGGGAGGGGGG - Intergenic
1147846011 17:43404266-43404288 GAGAGGAAAGGGAGGGAGTGAGG + Intergenic
1148131860 17:45266960-45266982 GTGGGTAAAGGGAGGGTGATGGG - Intronic
1148189383 17:45667982-45668004 GAGGGTGAGTGGGTGGAGAGGGG - Intergenic
1148281864 17:46354497-46354519 GATGGTGACCGGATGGAGAGAGG - Intronic
1148304089 17:46572436-46572458 GATGGTGACCGGATGGAGAGAGG - Intronic
1148770670 17:50064207-50064229 GAGGGGAAGGGGCTGGGGAGGGG + Intronic
1148786281 17:50147741-50147763 GAGGGGAAAGGGGTTGGGAGAGG + Intronic
1148805826 17:50263517-50263539 GAGGGTGAAGGGAGTGGGAGAGG + Intergenic
1148985000 17:51613421-51613443 GGGGGTAGAGGGAGGGAGAGAGG - Intergenic
1149291367 17:55220814-55220836 CAGGGGAAAGGGTGGGAGAGGGG - Intergenic
1149561019 17:57608091-57608113 GAGGGAAAAGGACTGCAGAGTGG + Intronic
1149639679 17:58194730-58194752 GGTGGTAAAGAGAAGGAGAGGGG - Intronic
1149981783 17:61316632-61316654 AAGGTTAGAGGGAGGGAGAGAGG + Intronic
1150208034 17:63423902-63423924 AGGGGTATAGAGATGGAGAGAGG - Exonic
1150411173 17:64941765-64941787 CAGGATAAAGGGGTGGAGAAAGG - Intergenic
1150486264 17:65546053-65546075 GAGGGAACAGGGCTGGGGAGGGG - Intronic
1150984840 17:70184519-70184541 GAGGGGAGAGGGAGGGGGAGGGG - Intergenic
1150984852 17:70184541-70184563 GAGGGGAGAGGGAGGGGGAGGGG - Intergenic
1151016189 17:70555872-70555894 GAGGGGGAAAGGAGGGAGAGAGG + Intergenic
1151197392 17:72441270-72441292 GGTGGTCAAGGGATGGGGAGAGG + Intergenic
1151362952 17:73599573-73599595 GAGGGAAAAGAGGAGGAGAGAGG + Intronic
1151366024 17:73617102-73617124 GAAGGTGAAGGGCTGTAGAGGGG + Intronic
1152034116 17:77861502-77861524 GTGGGTAAATGGGTGGAGATGGG + Intergenic
1152233078 17:79124726-79124748 GCGGGGTAAGGGGTGGAGAGCGG - Intronic
1152328789 17:79658424-79658446 GAGGAGACAGGGAGGGAGAGAGG - Intergenic
1152430290 17:80245123-80245145 GAGGGAAAGGAGATGGGGAGGGG - Intronic
1152438216 17:80288944-80288966 GAGCGTGGAGGGAGGGAGAGAGG + Intronic
1152859078 17:82685203-82685225 GAGAGGAAAGGAATGGGGAGGGG + Intronic
1152913041 17:83016486-83016508 GAGTGAGAAGGGATGGAGGGAGG + Intronic
1153406814 18:4750117-4750139 AAGGTTAAAGGGAGAGAGAGTGG + Intergenic
1153789000 18:8560820-8560842 GAGGGAAAAGAGAAAGAGAGCGG - Intergenic
1153826630 18:8881445-8881467 TAGGGGAAAGGGAAGGAGAGAGG - Intergenic
1153904657 18:9650472-9650494 GAGGGAAAAGGGGAGGAGAGAGG + Intergenic
1153934032 18:9904899-9904921 GAGGCTGCAGGGAAGGAGAGGGG - Intergenic
1154089463 18:11344049-11344071 GAGGGTAGAGGGAGAGGGAGAGG - Intergenic
1154321242 18:13354986-13355008 GAAGGGAAATGAATGGAGAGAGG + Intronic
1155331918 18:24727528-24727550 GAGAGAAAAGGGGTAGAGAGAGG - Intergenic
1155464077 18:26116121-26116143 GAGGGTAAAGGGTGGGAGGAGGG + Intergenic
1156026127 18:32656547-32656569 GAGGGTTAAGGGTAAGAGAGGGG + Intergenic
1156051466 18:32940666-32940688 GAGGGTGAAGGGTGGGAGAAGGG - Intronic
1156198997 18:34808725-34808747 GAGGGTGATGGGATGGGGTGAGG - Intronic
1156208639 18:34913865-34913887 GAGGGGAAGGTGATGGAGTGGGG - Intergenic
1156238179 18:35224532-35224554 GAGGGTGAAGGGTAGGAGAAGGG + Intergenic
1156261806 18:35451468-35451490 GAGGGAAAAGGGTAGGAGGGAGG + Intronic
1156546107 18:37965209-37965231 GAGAGAAAAGGGATGGAAAGGGG - Intergenic
1156602932 18:38631318-38631340 CAGGGTAAAGGGAGAGAAAGGGG + Intergenic
1156883263 18:42105739-42105761 AAGTGTAAAGGGATTGAGGGAGG - Intergenic
1156992012 18:43420397-43420419 GAGGGGGAAGGGAGGGAGGGAGG - Intergenic
1157055211 18:44219922-44219944 CAGGGTAAAGGGTGGGAGTGAGG + Intergenic
1157244263 18:46039584-46039606 GAAGGAAAAAGGAAGGAGAGAGG - Intronic
1157484351 18:48076412-48076434 GAGGGTAAGGGGAGGGAGGTGGG + Intronic
1157583599 18:48787388-48787410 AAGGAGGAAGGGATGGAGAGAGG + Intronic
1157604832 18:48919533-48919555 TAGGGTAATGGGAAGGAGACAGG - Intergenic
1158126921 18:54110412-54110434 GAGGGTGAAGGGTGGGAGGGGGG - Intergenic
1158377113 18:56883657-56883679 CAGGGGAAAGGGTGGGAGAGGGG - Intronic
1159635778 18:70803129-70803151 GAGGGTGGAGGGTTGGAGAGGGG + Intergenic
1159823731 18:73178732-73178754 GAGAATCAAGAGATGGAGAGGGG + Intronic
1159964113 18:74579324-74579346 GAGGGGGAGGGGATGGAGAGGGG - Intronic
1160122977 18:76146983-76147005 GAGGGTAATGGGATGAGGAAGGG + Intergenic
1161139329 19:2638429-2638451 GAGGGGAAGGGGAGGGGGAGGGG + Intronic
1161329021 19:3677767-3677789 GAGGATGGAGGGATGGAGGGAGG + Intronic
1161403833 19:4081026-4081048 GAAGGGAAGGGGAGGGAGAGAGG + Intergenic
1161471190 19:4457475-4457497 GAGGGTCAGGGGAGGGGGAGAGG - Intronic
1162012079 19:7823479-7823501 GAGGGGAGGGGGATGGAGGGGGG + Intergenic
1162178524 19:8849697-8849719 GAGGAGGAAGGGAGGGAGAGAGG - Intronic
1162405055 19:10468399-10468421 AAGGGAAAGGGGATGGAGAGTGG - Exonic
1162565635 19:11444790-11444812 GAGGATACAGGGAGGGAGACCGG - Intronic
1162777252 19:12987372-12987394 GAGGGGAGAGGGAAGGAGAAGGG + Intergenic
1162791678 19:13066276-13066298 TGGGGTCAGGGGATGGAGAGGGG + Intronic
1162968836 19:14168133-14168155 GAGGGGCCAGGGATGCAGAGGGG - Intronic
1163297479 19:16421706-16421728 GCGGGTGATGGGGTGGAGAGAGG - Intronic
1163351067 19:16777213-16777235 GAGGGGAAAGGGAAGGGGAGGGG + Intronic
1163351316 19:16777842-16777864 GAGGGGAAAGGGAAGGGAAGAGG + Intronic
1163976623 19:20858847-20858869 TAGGGGAAAGGGAAGGAGAGGGG + Intronic
1164080645 19:21858955-21858977 GAGGGTAGAGACATGGAGAGAGG - Intergenic
1164292468 19:23880477-23880499 GAAGGAAAAGGGAAGGAGACAGG + Intergenic
1164432810 19:28202615-28202637 GAGGGTAGAGGGTTGGAGGAGGG + Intergenic
1164581336 19:29437184-29437206 GAGTGTAAAGAGGTGGAGTGGGG + Intergenic
1164581800 19:29439313-29439335 GGGGATAATGGGAGGGAGAGGGG + Intergenic
1164827639 19:31296224-31296246 GTGGGGAATGGCATGGAGAGAGG + Intronic
1164937082 19:32223392-32223414 GAGGGTAGAAGGAAGGATAGAGG + Intergenic
1165312935 19:35039727-35039749 GAGGGGAAGGGGATTGGGAGGGG + Intronic
1165792521 19:38500580-38500602 GGGAGTAGAGGGAGGGAGAGGGG - Intronic
1165998680 19:39864097-39864119 ACGGATAAAAGGATGGAGAGTGG + Intronic
1166040096 19:40197095-40197117 GAGGGTAAACTGATGGAGGCTGG + Intronic
1166075850 19:40413401-40413423 GGGGGAAAAGGAATGGGGAGGGG + Intergenic
1166090049 19:40502957-40502979 CAGGGTAAAGGGACGGAGGGCGG + Intronic
1166505361 19:43368185-43368207 GAGGGGAGAGGCATGGACAGAGG - Intergenic
1166509095 19:43392219-43392241 GAGAGGAGAGGCATGGAGAGAGG + Intergenic
1166527862 19:43524426-43524448 GGGGGAAAAGGGAAGGATAGGGG + Intronic
1166881611 19:45933777-45933799 GAGGGGAAAGGGGTGGGGAAAGG + Exonic
1166917033 19:46202499-46202521 GAGGGTAGAGACATGGAGAGGGG + Intergenic
1166948037 19:46409138-46409160 GAGGGAGAGGGGAGGGAGAGAGG + Intergenic
1167055736 19:47111122-47111144 GAGGGAATGGGGGTGGAGAGGGG - Intronic
1167210777 19:48132969-48132991 GAGGGCACAGGTATGGGGAGTGG - Exonic
1167856908 19:52249169-52249191 GATGGTCAAGGTATGGATAGTGG + Intergenic
1167913431 19:52721672-52721694 GAGGGGAAAGGGAGAGAGGGAGG + Intronic
1168135589 19:54349218-54349240 GAGGGTGGATGGATGGAGGGAGG + Intergenic
1168135655 19:54349492-54349514 GAGGGTGGACGGATGGAGGGAGG + Intergenic
925100591 2:1241619-1241641 GAGGATTAAGGGGTGGGGAGAGG - Intronic
925129194 2:1482322-1482344 GAAGGCAAAGAAATGGAGAGTGG + Intronic
925212344 2:2060716-2060738 GAGGGAAAAGGAAGGGAGGGGGG - Intronic
925356727 2:3246926-3246948 AAGGATGAAGGGAGGGAGAGAGG + Intronic
925451292 2:3971266-3971288 GAGGGGAAAGGGGAGGACAGGGG + Intergenic
925507709 2:4586786-4586808 GAAGGAAGAGGGAGGGAGAGAGG - Intergenic
925665014 2:6243891-6243913 GAGGGTACCGTGATGGACAGTGG - Intergenic
925665701 2:6252977-6252999 CAGGGAAACGGGATGGAGGGAGG - Intergenic
925719533 2:6813696-6813718 GAGGAAAAAGGGAGGGAGCGGGG + Intergenic
925881054 2:8352975-8352997 GAGGGAAGAGGGAAGGGGAGAGG + Intergenic
925965678 2:9063025-9063047 GAAGGGAAAGGGAGGGAGGGAGG + Intergenic
926059244 2:9794895-9794917 GAGGGTGGAGGGAGGGAGGGAGG - Intergenic
926309968 2:11668320-11668342 GAGGGTATAGGAAGAGAGAGGGG + Intronic
926728250 2:16015113-16015135 GAAGAGAAAGGGATGGAGAGAGG + Intergenic
927036085 2:19177887-19177909 GATGGGAGTGGGATGGAGAGAGG - Intergenic
927088026 2:19690091-19690113 GAGGGGAAGGGGAAGGGGAGGGG + Intergenic
927232184 2:20834685-20834707 GAGGGAAAGGGGAGGGGGAGGGG - Intergenic
927343566 2:22010243-22010265 GAGGGAGAGGGGATAGAGAGGGG - Intergenic
927521690 2:23702909-23702931 GTGAGCAAAGGGATGGAGACAGG + Intronic
927578874 2:24223742-24223764 AAGGGGAAAGGGAAGGGGAGGGG + Intronic
927691584 2:25212302-25212324 GAAGGAAATGGGATGGAAAGGGG - Intergenic
927801141 2:26100969-26100991 TAGGGTAAAGTGTTGGAGAATGG + Intronic
927986262 2:27413177-27413199 GAGGGGAATAGGATGGTGAGGGG - Intergenic
928154058 2:28859598-28859620 GAGGGAATAGAGAAGGAGAGGGG - Intronic
928318242 2:30262691-30262713 GAGGGGAAAGGCAAGGAGAAGGG + Intronic
928453498 2:31399307-31399329 GAGAGTATAGGGATGAAGAAGGG + Intronic
928623971 2:33120322-33120344 GAGGGTAAAAGGAGGGAGAAGGG - Intronic
928794241 2:34997334-34997356 GAGGGAAAAGGAGTGGGGAGGGG - Intergenic
929003211 2:37368294-37368316 GAGGGATTAGGGATGGAGTGTGG - Intronic
929247111 2:39714222-39714244 GTGGGAAGGGGGATGGAGAGAGG + Intronic
929279856 2:40066041-40066063 GAGGGAGAAGGGAGGGAGGGGGG - Intergenic
929302727 2:40324652-40324674 GAAGGGAAAGGAAGGGAGAGAGG - Intronic
929511347 2:42568429-42568451 GAGGGGAAAGGGAGTGGGAGTGG - Intronic
929642532 2:43596046-43596068 CAGGGCAAAGGGAGGGAGAGAGG + Intronic
929773899 2:44915817-44915839 GTGGGGAGAGGGAGGGAGAGAGG + Intergenic
930262788 2:49166688-49166710 GAGGAGGAAGGGAGGGAGAGAGG + Intergenic
930288525 2:49465351-49465373 GAGGGAAAGGGGAAGGGGAGAGG - Intergenic
930288545 2:49465408-49465430 GAGGGAAAGGGGAAGGGGAGAGG - Intergenic
930772177 2:55139586-55139608 GAGGCTTAGGGGATGGATAGTGG - Intergenic
930847776 2:55923824-55923846 GAGGAGAAAGGGAGGGAAAGGGG + Exonic
931385737 2:61795931-61795953 AAGTGTAAGGGGATGGAGAGAGG - Intergenic
931417992 2:62099522-62099544 GAGAGGAAAGGCAAGGAGAGCGG - Intronic
931908439 2:66868512-66868534 GAGAGAAAAGAGATGGAGAGTGG + Intergenic
932302538 2:70677234-70677256 GAGGGGAGAGGGAGGGAGGGTGG + Intronic
932462943 2:71895122-71895144 GAGGAGAGAGGGAGGGAGAGAGG - Intergenic
932469605 2:71945244-71945266 GAGGGGAAATGGAGGCAGAGTGG - Intergenic
933018191 2:77158120-77158142 GAGGGAGGAGGTATGGAGAGAGG + Intronic
933042660 2:77488088-77488110 GAGGGAAGAGAGAAGGAGAGAGG + Intronic
933045361 2:77528681-77528703 GTGGGTAAGGGGTTGGAAAGTGG + Intronic
933059751 2:77722898-77722920 GAGGGTGAAGGGTTGGAGGAGGG + Intergenic
933320581 2:80771352-80771374 GAGGGAAAAGGGAGGGAGAGAGG - Intergenic
934082135 2:88477861-88477883 GAGGAGGAAGGGAGGGAGAGAGG - Intergenic
934519848 2:95013305-95013327 GAGGGTAGAGGTGTGCAGAGGGG - Intergenic
934680178 2:96278068-96278090 GGTGGTAATGGGATGGAGATGGG + Intronic
935308328 2:101759488-101759510 GAGGGGAGAGGGGAGGAGAGGGG - Intronic
935308428 2:101759694-101759716 GAGGGGAGAGGAATGGGGAGGGG - Intronic
935308434 2:101759706-101759728 GATGGTAAAGGGGAGGGGAGAGG - Intronic
935347680 2:102123948-102123970 GAGGTGAAAGGGATGGAAAGGGG + Intronic
936458973 2:112697341-112697363 GGGAGAGAAGGGATGGAGAGAGG - Intergenic
936928792 2:117765276-117765298 GAGGGTGAAGGGAGGGAAGGAGG + Intergenic
937138460 2:119576339-119576361 GAGGGTGAGAGGAGGGAGAGGGG - Intronic
937348504 2:121143444-121143466 GAGGGCAAGGGGAGGGAGAGTGG + Intergenic
937647286 2:124279850-124279872 GAGGGTGAAGGTAAGGAGATTGG - Intronic
937737284 2:125307256-125307278 GAGAGGGAAGGGAGGGAGAGAGG + Intergenic
937766044 2:125661594-125661616 AAGGGTAAAGGGAGGGATAGTGG + Intergenic
938023916 2:127928293-127928315 GAGAATAAGGGGATGAAGAGAGG + Intergenic
938164297 2:129012648-129012670 CAGGGCAGAGGGATAGAGAGTGG - Intergenic
938188341 2:129253090-129253112 GAAGCCACAGGGATGGAGAGAGG + Intergenic
938236503 2:129710400-129710422 GAGGGCAGAGGGAGGGAGGGAGG + Intergenic
938993409 2:136652905-136652927 GAGGTTAAAGGGATGGACTTTGG + Intergenic
939303162 2:140373939-140373961 AAAGGAAAAGAGATGGAGAGAGG - Intronic
939671244 2:145015367-145015389 CAGGGTAGAGGGAGGGAGAGGGG - Intergenic
939794853 2:146630373-146630395 GAGGAGAGAGGTATGGAGAGGGG - Intergenic
940612138 2:156005984-156006006 GTGGGTGAAGGGAAGGAGAGAGG - Intergenic
940887184 2:159000184-159000206 GTGGGTAAGTGGATGGAGCGTGG + Intronic
941186587 2:162326882-162326904 CAGGGATAAGGGGTGGAGAGTGG - Intronic
941670645 2:168288839-168288861 GAGGGAAAGTGGATGGATAGTGG + Intergenic
942507334 2:176656950-176656972 GAGGGGAAAGGGTGGGAGAGGGG + Intergenic
942635660 2:178002059-178002081 GAGGGGGAAGGGAGGGAGAGGGG - Intronic
942838766 2:180334606-180334628 GAAGGTAAAGAGAGAGAGAGAGG + Intergenic
942965853 2:181891901-181891923 GAGGGGACAGGGAGGGAGGGAGG - Exonic
943370428 2:187009619-187009641 AAGGGGGAAGGGATTGAGAGAGG - Intergenic
943699259 2:190972053-190972075 GGGGGTAAAGAGAGGGAGGGAGG + Intronic
944033443 2:195265065-195265087 CAGGGTATAGGGATGGGGAAAGG - Intergenic
944058621 2:195548316-195548338 GAAGGAAGAGGGATGGAGGGAGG + Intergenic
944085129 2:195836973-195836995 GAGAGAAAAGAGATGGAGAGAGG - Intronic
944155005 2:196598509-196598531 GAGGGGGAGGGGATGGAGAGAGG + Intergenic
944155016 2:196598531-196598553 GAGGGGGAGGGGATGGGGAGAGG + Intergenic
944212578 2:197221771-197221793 GAGTGTAAAGTGATAGACAGGGG + Intronic
944284680 2:197935611-197935633 GAGGGTAGAGGGTGGGAGAAGGG + Intronic
944832738 2:203549140-203549162 GAGAGGAAAGGGGAGGAGAGGGG - Intergenic
944910941 2:204309910-204309932 GAGGGCAAAAGGATGGAGGGAGG + Intergenic
945554543 2:211262671-211262693 GAGGGTAGAGACATGGAGAAGGG - Intergenic
945809165 2:214527245-214527267 GAGGGTGGAGGGAAGGAGTGGGG + Intronic
945857963 2:215090762-215090784 GAGGGTAGAGACATGGAGAGAGG - Intronic
946165200 2:217859355-217859377 GAGGGGAAAGGGGGAGAGAGAGG - Intronic
946194789 2:218026658-218026680 GTGGGAAAAGGGCTGGAGGGAGG - Intergenic
946221025 2:218227099-218227121 GAGGGTAAAGGGATGGTGCCTGG - Intronic
946506783 2:220309776-220309798 GAGGGGAAAGTGAAGAAGAGAGG + Intergenic
946632996 2:221691793-221691815 CATGGTAATGTGATGGAGAGTGG + Intergenic
946800504 2:223410853-223410875 AATGGTGGAGGGATGGAGAGAGG + Intergenic
946947126 2:224832775-224832797 GAGTGCTAAGGGATGGAGAGGGG - Intronic
947661239 2:231870084-231870106 GAGGGGAAAAGGAAGGAAAGAGG - Intergenic
947843627 2:233226231-233226253 GAGGGAGAAGGGGTGCAGAGAGG - Intronic
948005662 2:234605594-234605616 GAGGGCAGGAGGATGGAGAGAGG + Intergenic
948046228 2:234947534-234947556 GAAGGGAAAGGAGTGGAGAGGGG - Intergenic
948107426 2:235426822-235426844 GAGAGAAAAGGGAGGGAGGGAGG + Intergenic
948313190 2:237004959-237004981 GGGGCTGAAGGGATGGGGAGGGG + Intergenic
948344332 2:237282667-237282689 GAGGGGAAGGGGAAGGAGAAGGG + Intergenic
948344346 2:237282697-237282719 GAGGGGAAGGGGAAGGAGAAGGG + Intergenic
948660107 2:239501740-239501762 GAGGGGCAAGGGAGGGAGAGGGG + Intergenic
948748194 2:240110734-240110756 GAGGGGAAGGAGAAGGAGAGTGG - Intergenic
948779887 2:240312599-240312621 CAGGGGAAAGGGTGGGAGAGGGG - Intergenic
948842188 2:240657368-240657390 GAAGATAAAAGGATGGAGAAAGG - Intergenic
948871941 2:240805083-240805105 GAGGGAGAGGGGAGGGAGAGGGG + Intronic
949047294 2:241877827-241877849 GAGGGGAGAGGGACGGGGAGGGG - Intergenic
1168729856 20:66878-66900 GAGTGGAAAGGAATGGAGTGGGG - Intergenic
1168744095 20:221415-221437 GAGGAGAAAAGGAGGGAGAGAGG + Intergenic
1168744099 20:221434-221456 GAGGAGAAAAGGAGGGAGAGAGG + Intergenic
1168771138 20:417704-417726 GGGGGCAAAGAGAGGGAGAGTGG - Intronic
1168910071 20:1440504-1440526 CAGGTCAAAGGGATGGAGGGTGG + Intergenic
1168965285 20:1894850-1894872 GAGGGGAAAGGGAAGGAGGGAGG + Intronic
1169456679 20:5758342-5758364 GAGGGGGAGGGGAAGGAGAGGGG + Intronic
1169541628 20:6606108-6606130 AAGGGAAAAGGGAAGGAGGGCGG - Intergenic
1169597851 20:7221100-7221122 GAGGGGGAAGGGAAGGAGAGGGG - Intergenic
1169990565 20:11498334-11498356 GATGAGAAAGGGATGGAGGGAGG + Intergenic
1170080423 20:12468906-12468928 CTGGGTAGAGGGATGTAGAGGGG - Intergenic
1170126744 20:12972037-12972059 GAGGGTGAAGGGTTGGAGGAGGG - Intergenic
1170184049 20:13567268-13567290 GAGGGTGAAGGGTGGGAGGGGGG + Intronic
1170343978 20:15362936-15362958 GAGGGGAAAGGGGAGGGGAGGGG + Intronic
1170345960 20:15387488-15387510 GGGGGAAAAGGAATGGAGAAGGG - Intronic
1170619514 20:17983062-17983084 AAGAGGATAGGGATGGAGAGTGG - Intronic
1170764184 20:19275901-19275923 GAGGGGTAGGGGATGAAGAGGGG - Intronic
1170791942 20:19515821-19515843 TAGGGTTAAGTCATGGAGAGTGG - Intronic
1170927608 20:20740133-20740155 CAGGGTAAAGGGTGGGAGGGGGG + Intergenic
1170938246 20:20827872-20827894 GAGGGGGAAGGGAGGGAGGGAGG + Intergenic
1170957412 20:20993852-20993874 GAGGGAAGAAGGATGGGGAGGGG + Intergenic
1171001621 20:21421843-21421865 AAGGGGAAAGGAATGGGGAGGGG - Intergenic
1171290701 20:23981480-23981502 GAGGGTTAGGGGATAGAGATGGG - Intergenic
1171853842 20:30327209-30327231 GAGGGTGAAGGGATGCAAAAGGG + Intergenic
1172113953 20:32562965-32562987 GAGAGTGGAGGGGTGGAGAGTGG + Intronic
1172113973 20:32563026-32563048 GAGGGTAGAGGGAGGGAGAGTGG + Intronic
1172113999 20:32563099-32563121 GAGGGTGGAGGCAGGGAGAGTGG + Intronic
1172114010 20:32563130-32563152 GAGGCTGGAGGGAGGGAGAGTGG + Intronic
1172114020 20:32563161-32563183 GAGGGTGGAGGGAGGGAGAGTGG + Intronic
1172292181 20:33784246-33784268 GGGGGGAGAGAGATGGAGAGAGG - Intronic
1172740329 20:37161443-37161465 GGGGGGAAAGGGAGAGAGAGAGG + Intronic
1172946317 20:38692473-38692495 GAGGAGAAAGGGAGGGAAAGGGG - Intergenic
1173047987 20:39530987-39531009 AAGGGAAAAAGGATGGAGGGAGG - Intergenic
1173062859 20:39679003-39679025 CAGGGTACAGGGATGGAGTCTGG - Intergenic
1173182206 20:40814014-40814036 GAGAGAAAAGGGAGGGAGACAGG - Intergenic
1173380487 20:42535322-42535344 GAGGGTAGAGGGAGGGAGGAGGG + Intronic
1173550927 20:43932746-43932768 GAAGGCAAGGGGTTGGAGAGGGG + Intronic
1174362485 20:50037725-50037747 GAGGGAAGGGGGAGGGAGAGAGG - Intergenic
1174690802 20:52502527-52502549 GAGGGGGCAGGGATGGAGAATGG + Intergenic
1174737100 20:52974515-52974537 GAGGGTAAAGACAGAGAGAGAGG - Intronic
1174763499 20:53229760-53229782 GAGGGGGAAAGGAGGGAGAGAGG + Intronic
1175191910 20:57217053-57217075 AAGGGGAAAGGGATGGAGGCAGG + Intronic
1175284341 20:57827844-57827866 ATGGGGAAGGGGATGGAGAGTGG + Intergenic
1175451791 20:59075772-59075794 GTGGGAATAGGGATGGAGGGAGG + Intergenic
1175497881 20:59427225-59427247 GAAGGGAAAGGGAAGGAGATGGG + Intergenic
1175546216 20:59779608-59779630 CAGGGGAAAGAGAGGGAGAGAGG - Intronic
1175614998 20:60390472-60390494 GAGGGGAAAGGGAAGCAGAAGGG - Intergenic
1175627518 20:60501256-60501278 GAGGGTATAGAGATGAAGATAGG + Intergenic
1175725881 20:61318030-61318052 GAGACTAAAGGGCTGGAGGGTGG + Intronic
1175887529 20:62300954-62300976 GAAGCTAAAGGGCTTGAGAGGGG - Intergenic
1175934563 20:62509096-62509118 GAGGGTTGAGGGGTGGAGGGTGG - Intergenic
1175934812 20:62509763-62509785 GAGGGTGGAGGGATAGAGGGTGG - Intergenic
1175934859 20:62509892-62509914 GAGGGCGAAGGGATGGAGGATGG - Intergenic
1175935006 20:62510295-62510317 AGGGGTGAAGGGATGGAGACTGG - Intergenic
1175935016 20:62510326-62510348 GAGGATGGAGGGGTGGAGAGTGG - Intergenic
1176232702 20:64040251-64040273 GAGGACAAAGGGGTGGAGAGAGG + Intronic
1176267970 20:64220685-64220707 GAGGGGAAGGAGAGGGAGAGGGG - Intronic
1176513684 21:7767412-7767434 GAGGGGAGAGGGAGGGGGAGGGG - Intronic
1177080869 21:16637033-16637055 GATGGTAAAGGGGTTGGGAGGGG - Intergenic
1177275360 21:18905916-18905938 GAGAGTAAAGTAATGTAGAGCGG - Intergenic
1177480561 21:21681650-21681672 CAAAGTAAAGGGATGGAGACAGG - Intergenic
1177674377 21:24277323-24277345 GAGGGGAGAGGGAGGGAGTGGGG - Intergenic
1178005206 21:28211353-28211375 GAGGGTAGGAGGAGGGAGAGAGG - Intergenic
1178322306 21:31614791-31614813 AAGGGGAAAGGGAAGGGGAGGGG + Intergenic
1178507653 21:33176148-33176170 GAGGTAAAAGGGAGAGAGAGTGG - Intergenic
1178647797 21:34397936-34397958 GAGGGGAGAGGGAGGGGGAGGGG - Intronic
1178686258 21:34713008-34713030 GAGGGCAAAGGGAGTGAGACAGG - Intronic
1178808588 21:35860169-35860191 GAGGGAAAAGAGAGGGAGGGAGG + Intronic
1178836869 21:36105527-36105549 TAGGGAAAGGGGAAGGAGAGGGG + Intergenic
1179048694 21:37870034-37870056 GAGGATGAAGGGAAGGAGAAAGG + Intronic
1179135773 21:38678831-38678853 GAGGGGAAGGGGAGGGGGAGGGG + Intergenic
1179135805 21:38678891-38678913 GAGGGGAATGGGGAGGAGAGGGG + Intergenic
1179135818 21:38678913-38678935 GAGGGGGAGGGGATGGGGAGGGG + Intergenic
1179338964 21:40486484-40486506 AAGAGGAAAGGGAAGGAGAGAGG + Intronic
1179417661 21:41211165-41211187 GGGGGGAGAGGGATGGGGAGGGG - Intronic
1179725122 21:43337696-43337718 GCAGGAAGAGGGATGGAGAGAGG - Intergenic
1180131876 21:45832027-45832049 GAAGGTAAAGGGATAAAGAATGG + Intronic
1180186832 21:46144475-46144497 GAGGGAAAGGGGAGGGAGAGGGG - Intronic
1180643128 22:17315560-17315582 GAGCGTAAGGGGACGGAGAGAGG + Intergenic
1180766720 22:18349587-18349609 GAGGGTTAGGGGATAGAGATGGG + Intergenic
1180779594 22:18512791-18512813 GAGGGTTAGGGGATAGAGATGGG - Intergenic
1180812309 22:18770112-18770134 GAGGGTTAGGGGATAGAGATGGG - Intergenic
1181119803 22:20658131-20658153 GAAGGAAAAGGGGTGGTGAGAGG + Intergenic
1181198466 22:21204359-21204381 GAGGGTTAGGGGATAGAGATGGG - Intergenic
1181473343 22:23154090-23154112 GAGGGTAAGGGGTGGGAGAGTGG - Intronic
1181648264 22:24245451-24245473 GAGGGTTAGGGGATAGAGATGGG - Intergenic
1181656978 22:24309956-24309978 GAGGGAACAGGGGAGGAGAGGGG - Intronic
1181703240 22:24632522-24632544 GAGGGTTAGGGGATAGAGATGGG + Intergenic
1181829279 22:25546484-25546506 GAGGAGGAAGGGATGGAGGGAGG - Intergenic
1181896368 22:26111468-26111490 GAGGATAGAGGAAAGGAGAGGGG - Intergenic
1181897143 22:26120388-26120410 GAGGATGAAGGGATGAAGAGAGG + Intergenic
1181955372 22:26584374-26584396 GTGGACAGAGGGATGGAGAGCGG + Intronic
1182112844 22:27735544-27735566 GACGTTCAAGGGATGGAGACTGG + Intergenic
1182394854 22:30027901-30027923 GAGGGAAAAGGGACGAAGAGGGG - Intronic
1182859968 22:33551045-33551067 AAGGGTAAAGGGATGGGAAAGGG + Intronic
1182916580 22:34038392-34038414 GAAGATGAAGGGATGGAGAGAGG - Intergenic
1183261293 22:36797534-36797556 GAGGGGAGAGGGAGGGGGAGAGG + Intergenic
1183264490 22:36816907-36816929 GAGGGGAGAGGGATGGGGAGGGG + Intronic
1183392990 22:37556421-37556443 GAGGGCAGATGGATGGACAGGGG + Intergenic
1183422358 22:37719258-37719280 GAGGGGACAGAGAAGGAGAGAGG + Intronic
1183632205 22:39040409-39040431 GAGGGTGAAGGCCTGGGGAGAGG + Intergenic
1184022245 22:41828578-41828600 GGCAGTAAAGGGAGGGAGAGAGG - Intergenic
1184222928 22:43111977-43111999 GAGGCCACAGGGCTGGAGAGTGG - Intronic
1184345407 22:43909897-43909919 GAGGGAGAAGGGAGGGACAGAGG + Intergenic
1184671173 22:46012990-46013012 GAGGGCAAGGGGGTGGAGATGGG - Intergenic
1185015300 22:48339323-48339345 GAGGGAGAAGAGAGGGAGAGAGG + Intergenic
1185059326 22:48597852-48597874 GGGAGTTAAGGGATGGAGAAGGG + Intronic
1185202465 22:49516662-49516684 GAGGGGAATGGGAGGGAGAGAGG + Intronic
1185229777 22:49673488-49673510 GAAGGGGAAGGGAGGGAGAGGGG + Intergenic
1185354269 22:50357397-50357419 GAAAGAAGAGGGATGGAGAGAGG - Intronic
1185360762 22:50405339-50405361 GAGTGTGAAGGCCTGGAGAGAGG + Intronic
1185360773 22:50405398-50405420 GAGTGTGAAGGCCTGGAGAGAGG + Intronic
1185360792 22:50405497-50405519 GAGTGTGAAGGCCTGGAGAGAGG + Intronic
1185360808 22:50405575-50405597 GAGTGTGAAGGCCTGGAGAGAGG + Intronic
1185360819 22:50405634-50405656 GAGTGTGAAGGCCTGGAGAGAGG + Intronic
1185360830 22:50405693-50405715 GAGTGTGAAGGCCTGGAGAGAGG + Intronic
1185360842 22:50405752-50405774 GAGTGTGAAGGCCTGGAGAGAGG + Intronic
1185360876 22:50405908-50405930 GAGTGTGAAGGCCTGGAGAGAGG + Intronic
1185360900 22:50406043-50406065 GAGTGTGAAGGCCTGGAGAGAGG + Intronic
1185360917 22:50406123-50406145 GAGTGTGAAGGCCTGGAGAGAGG + Intronic
1185360968 22:50406376-50406398 GAGTGTGAAGGCCTGGAGAGAGG + Intronic
1185385182 22:50528657-50528679 GAAGGTGAAGGGATGCACAGAGG - Intronic
1185398003 22:50602233-50602255 GAGGGCACAGGGCTGCAGAGGGG - Intronic
1203228339 22_KI270731v1_random:90478-90500 GAGGGTTAGGGGATAGAGATGGG + Intergenic
949107105 3:212700-212722 AAGGATACAGGGACGGAGAGGGG - Intronic
949382831 3:3465022-3465044 GAGGGAAGAGGGAAGGGGAGAGG + Intergenic
949611439 3:5707763-5707785 AAGGGGAAGGGGAAGGAGAGGGG - Intergenic
949614603 3:5739582-5739604 GAGGGGAAGGGAAGGGAGAGAGG - Intergenic
949614627 3:5739640-5739662 GAGGGGAAGGGAAGGGAGAGAGG - Intergenic
949937921 3:9131300-9131322 GAGGGAAAGGGGTTGGAAAGAGG + Intronic
950702797 3:14761714-14761736 GGGGCTGAAGGGATGGAGTGGGG + Intronic
951167946 3:19505304-19505326 GAGGGTGAAGGGTTGGAGGAGGG + Intronic
951230938 3:20179092-20179114 GACTGAAAAGGGATGGAGATGGG + Intronic
951234311 3:20216829-20216851 GAGAGTACAGGGAAGGAGAATGG + Intergenic
951795921 3:26538222-26538244 AAGGGGAAAGGGAAGGAGAAGGG + Intergenic
951959444 3:28300622-28300644 GGAGGGAAAGGGATGGAGGGAGG - Intronic
951959451 3:28300640-28300662 GGAGGGAAAGGGATGGAGGGAGG - Intronic
952062687 3:29529353-29529375 GGGCAAAAAGGGATGGAGAGAGG + Intronic
952124852 3:30288679-30288701 GTGGGGAAAGGGATAGAGAGAGG + Intergenic
952213635 3:31254114-31254136 GAGGGAAAAGGGGTGGGGGGAGG - Intergenic
952386985 3:32848959-32848981 GGGGGTCTAGGGTTGGAGAGAGG + Intronic
952669699 3:35951769-35951791 CAAAGTAAAGGGATGGAGAAAGG - Intergenic
952696160 3:36267198-36267220 GACTGAAGAGGGATGGAGAGAGG - Intergenic
953297319 3:41732950-41732972 GAGGCTAAGGGCAGGGAGAGGGG + Intronic
953405536 3:42657971-42657993 GAAGGGAAAGGGAAGGAAAGGGG - Intronic
953489414 3:43336233-43336255 GGGAGGAAAGGGAAGGAGAGAGG - Intronic
953599591 3:44349517-44349539 GAGGGTAGAGACATGGAGAGAGG + Intronic
953963328 3:47283122-47283144 GAGGGAAAAGGGGTCGAGCGGGG + Intronic
954411239 3:50372124-50372146 GAGAGTAAGGGGAGTGAGAGAGG - Intronic
954411825 3:50374263-50374285 AAGGGGAAAGGGAAGGGGAGGGG + Intronic
954584608 3:51722388-51722410 GAAAGGAAAGGGAAGGAGAGAGG - Intergenic
954678476 3:52328325-52328347 CTGGGTGGAGGGATGGAGAGTGG - Intronic
955407709 3:58635910-58635932 GAGGCTGAAGGGATGGGGACAGG + Intronic
955408838 3:58642926-58642948 GAAGGGAAAGGGAGGGAGAGAGG - Intronic
955496660 3:59540636-59540658 GAGGGTAAAGGGAGGAAGGAAGG + Intergenic
955569211 3:60286013-60286035 GAGGGTAAGTGGGTGTAGAGGGG + Intronic
955611117 3:60758229-60758251 AAGGGTAAAGGGGAGGAAAGAGG - Intronic
955697240 3:61649120-61649142 AAGGGAAAAGGGAGGGAGGGAGG - Intronic
955833655 3:63030449-63030471 GAGGGGGAGGGGAGGGAGAGGGG + Intergenic
955956763 3:64298127-64298149 GAGGGTAAAGGGTGGGAGGAGGG - Intronic
956192643 3:66622069-66622091 GGTGGGTAAGGGATGGAGAGAGG - Intergenic
956193988 3:66634219-66634241 GAAGGGAGAGGGAAGGAGAGAGG - Intergenic
956240845 3:67128470-67128492 CAGGGGAAAGGGTAGGAGAGGGG + Intergenic
956290069 3:67651856-67651878 CAGGGTCATGGGATGGAGAATGG - Intronic
956539896 3:70324859-70324881 GAAAGAAAAGGAATGGAGAGAGG - Intergenic
956656868 3:71560905-71560927 GAAGGAAATGGGGTGGAGAGAGG + Intronic
956803685 3:72787712-72787734 GAGGGGAGAGGGAGGGGGAGGGG - Intronic
956851012 3:73228156-73228178 GAGGGAGAAGGGAGAGAGAGAGG - Intergenic
957119753 3:76074513-76074535 ATGGGTAAAGAGATGGACAGAGG + Intronic
957888310 3:86320313-86320335 GAGGGTGAAGGGAAGGAGGAGGG - Intergenic
958000113 3:87739811-87739833 GAGGGTAGAGAGAGGCAGAGGGG - Intergenic
958021942 3:88008321-88008343 GAGGGTGAGAGGAGGGAGAGGGG - Intergenic
958421798 3:93938954-93938976 GAGGGTAGAGACATGGAGAAGGG - Intronic
958462656 3:94418704-94418726 GATGGCAAAGGGATGGGGTGAGG - Intergenic
959049620 3:101512654-101512676 GAGGGAAAGAGGAGGGAGAGGGG + Intronic
959084458 3:101836106-101836128 GAGGGTAGAGGGACAGAGTGGGG + Intronic
959111774 3:102131269-102131291 GAGGGTAAAGGGTGGGAGGAGGG + Intronic
959250475 3:103935880-103935902 CTGGGTAAAGGGATGAGGAGAGG - Intergenic
959732408 3:109619117-109619139 GAGGGTAAGGGGAGGGTAAGGGG - Intergenic
959796276 3:110432410-110432432 GAGGGGAGAGGGAAGGAGGGGGG - Intergenic
959873155 3:111351168-111351190 GAAGGTAAAGGAATAGAGAATGG + Intronic
960114945 3:113884904-113884926 AAGGGAAAAGGGAGGGGGAGGGG - Intronic
960320985 3:116235474-116235496 AAGGAGAAAGGGAAGGAGAGAGG + Intronic
960400409 3:117190878-117190900 GAGGGTAGAGGGTTGGAGGAGGG + Intergenic
960883236 3:122367157-122367179 GAGGGTGAAGAGAAGGAGAGAGG + Intronic
960938168 3:122915981-122916003 GAGGACAAATGGATGGAAAGTGG - Intronic
961016828 3:123474943-123474965 GAGGGAAAAGGGATTGAAAATGG + Intergenic
961442236 3:126959942-126959964 GAGAGTAAAGGAAAGGGGAGCGG + Intronic
961570585 3:127795395-127795417 GAGGGGGAAGGGAGGGAGGGGGG + Intronic
961660243 3:128464840-128464862 GAGGGGGAAGGGAGGGAGGGAGG - Intronic
961802630 3:129464304-129464326 GAGGGGATTGAGATGGAGAGTGG + Intronic
962072249 3:132044774-132044796 GAGGGTGGAGGGGAGGAGAGGGG + Intronic
962571979 3:136722633-136722655 GAGGGGAGAGGGAGGGGGAGAGG - Intronic
962809154 3:138946884-138946906 TAGGGGAAGGGGAAGGAGAGGGG - Exonic
963077717 3:141362762-141362784 GAGGGGAAAAGGATGCTGAGGGG + Intronic
963520286 3:146354753-146354775 GAGGGTAGAGACATGGAGAAGGG - Intergenic
963628473 3:147703817-147703839 GAGGGTAGGGGGAGGGAGAATGG + Intergenic
963761736 3:149291909-149291931 GAGGATAAAGGAATTCAGAGAGG - Intergenic
963952158 3:151214594-151214616 GAGGGAAAAGGGAGGGGGAGAGG - Intronic
963979868 3:151525713-151525735 AAGGGTAAGGGTATGGAGTGGGG - Intergenic
964120700 3:153180310-153180332 GAGAATAAAGGGAGGGAGGGAGG - Intergenic
964146492 3:153470397-153470419 GAGGGAAAGGGGAAGGGGAGAGG - Intergenic
964372627 3:156016859-156016881 GAGGTCCAAGAGATGGAGAGAGG + Intergenic
964595262 3:158420020-158420042 GAGGGTAAAAGGAGGAAGTGGGG - Intronic
964617856 3:158688473-158688495 AAGGGTAAAGGGAAGGAAAGAGG - Intronic
964642214 3:158921025-158921047 GAGGGTGGAGAGATGGAGAGAGG - Intergenic
964963783 3:162463742-162463764 GAGGGTAAAAGGCGGGAGAAGGG - Intergenic
965147895 3:164929330-164929352 GTGGGGAAGGGGATAGAGAGAGG - Intergenic
965737399 3:171836029-171836051 CCAGATAAAGGGATGGAGAGGGG + Intergenic
965828484 3:172754197-172754219 GAGGGCAAAGGTGTGGAGAAGGG + Intronic
965935052 3:174098436-174098458 GAGGGTAAAAGGAGGGTCAGTGG + Intronic
965943799 3:174215893-174215915 GAGGTAAAAGGAATGGAGAGAGG - Intronic
966060538 3:175749202-175749224 GAGGGGAAGGGGAGGGAGAGGGG + Intronic
966341803 3:178933337-178933359 GAGGGTGAGAGGAAGGAGAGAGG + Intergenic
966569142 3:181421571-181421593 GAGGGGAAAGGGGTAGAAAGAGG + Intergenic
966888606 3:184390226-184390248 GAGAGTGAAGGGAAGGGGAGGGG - Intronic
966928784 3:184662499-184662521 GGGGGAAAAGGGAGTGAGAGAGG + Intronic
967087846 3:186110250-186110272 GGGGGTAAGGGGGCGGAGAGGGG - Intronic
967350772 3:188511325-188511347 GAGGGACAAGGGAGGGAGGGAGG - Intronic
967568493 3:190999697-190999719 GAGAGTGAAGGGAGGGAGGGAGG + Intergenic
967712392 3:192724016-192724038 AAGGGAAAAGGGAGGGAGAAAGG + Intronic
967788219 3:193520174-193520196 GGTGGGAAAGGGAGGGAGAGAGG + Intronic
967994202 3:195154461-195154483 GAAGATTAAGGGAGGGAGAGAGG + Intronic
968460308 4:721483-721505 GAGGGTGCCGGGGTGGAGAGCGG + Intronic
968669167 4:1839439-1839461 GAGGGTGAAGGCATCGAGAGTGG + Intronic
968894081 4:3388632-3388654 GAGGGTCCAGGGCTGGAGCGGGG - Intronic
969032204 4:4224390-4224412 GAGGGAATAGGGAGGGAGGGAGG + Intronic
969225937 4:5798463-5798485 GTTGGAAAAGGGATGGAGAAAGG - Intronic
969433961 4:7173339-7173361 GAGGGTAAAGGAAGGGAAACAGG + Intergenic
969458261 4:7313454-7313476 GAGGGTAAAGGGAGGAGGAGCGG + Intronic
969474130 4:7411640-7411662 GAGCCTAAATGGATGGAGGGAGG - Intronic
969607812 4:8211234-8211256 GTGGGGAGAGGGAGGGAGAGGGG - Intronic
969686171 4:8675506-8675528 GAGGGCACCGGGCTGGAGAGGGG + Intergenic
969705059 4:8787193-8787215 GGGAGTTAAGGGAAGGAGAGAGG + Intergenic
969920054 4:10530008-10530030 GAAGGAAAAGGGAAGGAGGGAGG - Intronic
970450935 4:16166032-16166054 CAGGGAAAAGGACTGGAGAGGGG - Intronic
970487223 4:16536691-16536713 GTGGGTCAGGGGATGGAGAATGG + Intronic
970535159 4:17023097-17023119 GAGGGAAAAAAGCTGGAGAGGGG + Intergenic
970563832 4:17311400-17311422 AAGGGGAAAGGGAGGAAGAGGGG + Intergenic
971311581 4:25529949-25529971 GGGAGGAAAGGGAAGGAGAGGGG + Intergenic
971412121 4:26384974-26384996 GAGGGGAGAGGGGAGGAGAGAGG - Intronic
972014778 4:34230204-34230226 GATGATAAAGGGATGGAAAAAGG - Intergenic
972386804 4:38574878-38574900 GAGAGAAAAGGAATGCAGAGAGG - Intergenic
972445824 4:39142899-39142921 GAGGTTAGAGATATGGAGAGAGG + Intergenic
972574618 4:40340210-40340232 CTGTGTAAAGGGGTGGAGAGTGG - Intronic
972641846 4:40932642-40932664 GAGGGTGAAGGGGAGGGGAGGGG + Intronic
972784754 4:42315800-42315822 TAGGGAAAGGGGAAGGAGAGGGG + Intergenic
972822881 4:42722631-42722653 GGGGGAAAAGGGCTGGACAGAGG - Intergenic
973614664 4:52666353-52666375 GAGGAAAAAGGGAAGGAGGGAGG + Intergenic
973738993 4:53901594-53901616 GAGGGGGAAGGGAAGGGGAGGGG + Intronic
974517755 4:62938960-62938982 GAGGGTAAAAGGAGGAGGAGGGG - Intergenic
974902810 4:68022039-68022061 CTGGGAAAAGGGATGTAGAGAGG - Intergenic
975060099 4:69986207-69986229 GCTGGAAAAGGGATGGGGAGTGG + Intergenic
975360247 4:73460994-73461016 GAAGGGAAAGGGAGGGAGATGGG - Intergenic
975551442 4:75616954-75616976 GAGGGCAAAGGGTGGGAGAAGGG + Intronic
975600596 4:76095848-76095870 GAGGGTAAGGTGAAGGTGAGGGG - Intronic
975660444 4:76683433-76683455 GAGGGTAAAGGCAAGGAAGGAGG - Intronic
976744748 4:88391950-88391972 GAGGGGAAAGGAGTGGGGAGGGG - Intronic
976753812 4:88477426-88477448 GAAGGGAAAGGGACGGGGAGGGG + Intronic
976836581 4:89381220-89381242 GAAGGTAAAGAGGTGGAGGGAGG - Intergenic
976967230 4:91058157-91058179 GAGGGTGAAGGGTGGGAGAAGGG - Intronic
977762961 4:100761167-100761189 TAGGGTAAAGGGGTGGAAAAAGG + Intronic
978105194 4:104893467-104893489 GAAGGGAGAGGGAAGGAGAGTGG + Intergenic
978243758 4:106548721-106548743 GAGGGGGAAGGGAGGAAGAGAGG - Intergenic
978277352 4:106967903-106967925 GCAGGTTAAGGGATGGAGAGAGG + Intronic
978303390 4:107294964-107294986 GAGGGTAGAGACATGGAGAAGGG + Intergenic
978739254 4:112119047-112119069 GAGGGAAGAGGGGAGGAGAGGGG + Intergenic
979072625 4:116228630-116228652 GAGGGAGAAGAGATAGAGAGAGG + Intergenic
979128574 4:117009404-117009426 GATGGAAAAGGGAAGGAGGGAGG + Intergenic
979168239 4:117564404-117564426 GAGGGGGAAGGGTGGGAGAGGGG - Intergenic
979292454 4:118992662-118992684 GAGGGCTCAGGGATGGTGAGAGG - Intronic
979309448 4:119185092-119185114 GAGGGGAAGGGAAGGGAGAGGGG - Intronic
980060476 4:128123461-128123483 CTGGGTAAAGGGATAGAGAATGG - Intronic
980586378 4:134821937-134821959 CAGGGAAAAGGGTGGGAGAGGGG - Intergenic
980589969 4:134873659-134873681 GAAGGTAGATGGAGGGAGAGAGG + Intergenic
980673431 4:136042140-136042162 GAGGGTGAAGGGTGGGAGAAGGG - Intergenic
980720115 4:136684739-136684761 TAGGGAAAAGAGATGGAAAGGGG - Intergenic
980896944 4:138869015-138869037 GAGGGGAGAGGGGAGGAGAGAGG + Intergenic
981733292 4:147922233-147922255 GAGAGTGAAGGGAGGGAGGGAGG + Intronic
982254151 4:153435905-153435927 GGGGGTAAAGGTTCGGAGAGGGG - Intergenic
982441252 4:155438795-155438817 TAGGGTAATGGAATAGAGAGGGG - Intergenic
982485407 4:155959525-155959547 GAGGGTCTAGGGCTGGAGACTGG + Intergenic
982534466 4:156592502-156592524 GAGGGGAAGGTGATGGAGATAGG - Intergenic
982884021 4:160755631-160755653 GAAGGAAAAGTGATGGAGTGAGG - Intergenic
982904770 4:161053888-161053910 AAGGCAAAAGGGAAGGAGAGGGG + Intergenic
983261489 4:165461537-165461559 GAGGGAAAAGAGCTGGAGAGAGG + Intronic
984446595 4:179844628-179844650 TAAGGTAGAGGGATGGAGTGTGG - Intergenic
984599043 4:181705108-181705130 GTGGGTAGAGGGATGGGGAATGG + Intergenic
984831834 4:183983167-183983189 GCGAGTAAAGGGGTGGGGAGAGG - Intronic
984885021 4:184442300-184442322 GGAGGTGAAGGGGTGGAGAGAGG - Intronic
985006509 4:185539943-185539965 GAGGGGATAGGGATGGAGCAAGG + Intergenic
985030525 4:185784516-185784538 GATGATACAGCGATGGAGAGAGG + Intronic
985208645 4:187568437-187568459 GAGAGAGAAGGGATGGAGGGAGG - Intergenic
985273375 4:188216087-188216109 GAGGGAGGAGGGAAGGAGAGAGG - Intergenic
985273423 4:188216230-188216252 GAGGGAGGAGGGAAGGAGAGAGG - Intergenic
985273460 4:188216337-188216359 GAGGGAGGAGGGAAGGAGAGAGG - Intergenic
985678474 5:1244167-1244189 GGGGGTAAGGGGATGGGGAGTGG - Intronic
985783126 5:1881225-1881247 GAGGAAAAAGGGGTGGAGAAAGG + Intronic
985816155 5:2129795-2129817 GAGGGTGCAGCGAGGGAGAGGGG + Intergenic
986231477 5:5868191-5868213 GAGAGTGAAGGGATGGATGGGGG - Intergenic
986241703 5:5965642-5965664 GAGGGTAAGGGGACGGAGAGTGG - Intergenic
986313354 5:6571075-6571097 GAGGGAAGAGGGAAGGAGGGTGG + Intergenic
986467375 5:8039230-8039252 GAGGGTATAGGGAGGAAGAAGGG - Intergenic
987458101 5:18171719-18171741 GAGGGGGAAGGAAGGGAGAGGGG + Intergenic
987725927 5:21699559-21699581 GAGGGTGAAGAGTGGGAGAGTGG - Intergenic
988197078 5:28017455-28017477 AAAGGGAAAGGAATGGAGAGGGG + Intergenic
988680559 5:33480836-33480858 GAAGGGGAGGGGATGGAGAGGGG - Intergenic
988680577 5:33480886-33480908 GAAGGGGAGGGGATGGAGAGGGG - Intergenic
988718488 5:33852468-33852490 GAGGGTGAGTGGATGGAGAATGG + Intronic
989056575 5:37371319-37371341 GAGGGAACAGGGAAGGAGAGGGG + Intergenic
989069658 5:37497260-37497282 GAGGGAAAAGGGAGGGAGGAAGG - Intronic
989199543 5:38750073-38750095 CAGGGCAAGGGGATGGAGAGAGG + Intergenic
989513300 5:42313609-42313631 GAGGGTAGAGGGTAGGAGGGAGG - Intergenic
989524072 5:42432966-42432988 GAGGGCAAAAGGATGTAGATAGG + Intronic
989759240 5:44992325-44992347 GTAGGTTAAGGGATGGAAAGGGG - Intergenic
989782405 5:45284138-45284160 GAGGATAGAGGGTAGGAGAGAGG + Intronic
989796661 5:45482752-45482774 GAGGGTAGAGGGAGGAAGAGGGG - Intronic
989826435 5:45862455-45862477 GAAGGAAAAGAAATGGAGAGTGG + Intergenic
990076655 5:51853569-51853591 CAGTGTAAAGGGGTGGAGATGGG + Intergenic
990998782 5:61761093-61761115 GAGGGTGAAGGGAGGGAGGAGGG + Intergenic
991227147 5:64286100-64286122 GAGGGTAAGTGTATGGAGGGAGG - Intronic
991396981 5:66214242-66214264 AAGAGTGAAGGGGTGGAGAGAGG - Intergenic
992116170 5:73540486-73540508 GAGTGTTGAGGGAGGGAGAGAGG + Intergenic
992198110 5:74359575-74359597 GAGGGTGAGGGGAAGGGGAGAGG + Intergenic
992374510 5:76175054-76175076 GAAGGGGAAGGGAAGGAGAGGGG + Intronic
992520159 5:77542273-77542295 GAGGGTAAAGGGTGGGAGGAGGG + Intronic
992655661 5:78907204-78907226 GAGGGCAAGGGGATGGGGCGGGG + Intronic
992828391 5:80570717-80570739 GTGGGTACAGGGATGCGGAGGGG - Intergenic
992872766 5:81023079-81023101 GAGGGTAGAGGGTGGGAGGGAGG + Intronic
992936049 5:81706331-81706353 GAGGGGAGAGGGAAGGATAGAGG + Intronic
993050413 5:82920000-82920022 CAGGGTAAAGGAAAGGAAAGGGG - Intergenic
993055412 5:82974788-82974810 TAGGGGAAGGGGAAGGAGAGGGG - Intergenic
993204576 5:84863302-84863324 GGGAGGAAAGGGAGGGAGAGAGG - Intergenic
993223355 5:85132861-85132883 GAGGGGGAAGGGAGGGAGAGGGG - Intergenic
993257296 5:85607631-85607653 ATGGGGGAAGGGATGGAGAGAGG + Intergenic
993505567 5:88704905-88704927 CAGGGGAAAGGGTGGGAGAGGGG + Intergenic
993696697 5:91070104-91070126 GATGGGAAAGGGATGGAGGGGGG + Intronic
993900716 5:93582733-93582755 GAGGGGGAAGGGATGACGAGGGG - Intergenic
994084584 5:95744045-95744067 GAGAGAAGAGGGAAGGAGAGAGG - Intronic
994153633 5:96477792-96477814 GAGGATCAAGGGAATGAGAGAGG + Intergenic
994409395 5:99388088-99388110 AAGGGAAAAGGGAGGGAGGGAGG - Intergenic
995080517 5:108046709-108046731 GGGAGTAAAGGGATGCAAAGAGG - Intronic
995108118 5:108398617-108398639 GAGGGCAAAGTGAGGCAGAGTGG + Intergenic
995266126 5:110163227-110163249 GTGGCTAAAGGAATGGAGTGAGG + Intergenic
995701693 5:114942733-114942755 GAGGCAAGAGGGATTGAGAGGGG + Intergenic
995789442 5:115868915-115868937 GAGGATGAAGGGAGGGAGGGAGG + Intronic
996019063 5:118572413-118572435 GTAGGGAAAGGGAGGGAGAGGGG - Intergenic
996408526 5:123130195-123130217 AAGGGAAAAGGGAAGGGGAGAGG - Intronic
996638757 5:125728258-125728280 CAGAGCAAAGGGATGGAGAGTGG + Intergenic
996874176 5:128223195-128223217 GAGGAGAAAGGGAGAGAGAGGGG - Intergenic
996882583 5:128316988-128317010 GAGGGGACAGGGATGAGGAGAGG - Intronic
997559462 5:134833429-134833451 GAGAGTAAATGTATGTAGAGGGG + Intronic
997583781 5:135033222-135033244 AAGGGTAAACGGGGGGAGAGGGG - Intronic
997917723 5:137944950-137944972 GAGGGGGAAGGGAGGGAGGGGGG + Intronic
998124250 5:139605708-139605730 GAGGGAGAAGGGAGGGAGAGAGG - Intronic
998493241 5:142565081-142565103 GAGAGGGAAGGGAAGGAGAGAGG + Intergenic
998552783 5:143093734-143093756 TAGGGGAAGGGGAAGGAGAGGGG - Intronic
998738469 5:145170833-145170855 GAGGGTATAGGGAGGGAGGTGGG - Intergenic
998782251 5:145670603-145670625 GAGGCTAAGGCAATGGAGAGTGG - Intronic
998891911 5:146755161-146755183 GAGAGGAGAGGGATGGAGGGTGG + Intronic
999030160 5:148281580-148281602 GAGGGTAAACAGAAGCAGAGTGG - Intronic
999329124 5:150660806-150660828 GAAGGTAGAGGGAGGGAGGGAGG + Intergenic
999523439 5:152376882-152376904 GAAGTTAATGGAATGGAGAGAGG - Intergenic
999580340 5:153031439-153031461 GTGAATAAAGGGATGGAGATAGG - Intergenic
999818826 5:155203911-155203933 TAAAGTAAAGGGATGGAAAGAGG + Intergenic
1000113859 5:158135184-158135206 GAGGGGATAGGGAAGGAGAGAGG + Intergenic
1000113879 5:158135241-158135263 GAGGGGATAGGGAAGGAAAGAGG + Intergenic
1000113886 5:158135260-158135282 GAGGGGATGGGGAAGGAGAGAGG + Intergenic
1000115366 5:158148917-158148939 GAGGGGAAGGGGAGGGAGGGAGG - Intergenic
1000126370 5:158247760-158247782 GAGGGATAAGGGGAGGAGAGTGG + Intergenic
1000169691 5:158689931-158689953 GAGGAGAAATGGAAGGAGAGGGG + Intergenic
1000185127 5:158851536-158851558 GAGGGGAGAGGGGAGGAGAGAGG + Intronic
1000287586 5:159840110-159840132 GAGAGTCAAGAGATGGAGAGGGG - Intergenic
1000359781 5:160436279-160436301 GAGGGTAGAGGGAGAGAGTGTGG + Intergenic
1000495357 5:161976243-161976265 GAGGGTAAAGGGTGGGAGGAGGG - Intergenic
1000800006 5:165714086-165714108 GAGGGAAAGGGGAGAGAGAGAGG - Intergenic
1001134370 5:169090226-169090248 GAGGGTGAAGGGGAGGAGGGAGG + Intronic
1001466969 5:171976043-171976065 GAGGATGGAAGGATGGAGAGAGG + Intronic
1001576604 5:172768820-172768842 GAGTGGACAGGGATGGAGACGGG + Exonic
1001895143 5:175372351-175372373 GAGGGTGAAGGGTGGGAGTGGGG - Intergenic
1001961928 5:175884655-175884677 GAGGGTGCATGGAAGGAGAGGGG - Intergenic
1002822963 6:745436-745458 GAGGGTAAAGGGTGGGAGGAGGG + Intergenic
1002860017 6:1072035-1072057 GAGGAGAGAGGGCTGGAGAGTGG + Intergenic
1002861074 6:1080179-1080201 GAGGGTGAGAGGAGGGAGAGGGG - Intergenic
1003396090 6:5753133-5753155 GAGGGCAATGAGGTGGAGAGAGG + Intronic
1003443504 6:6164776-6164798 GAGGAGAAAAGGATGGAGGGAGG - Intronic
1003495008 6:6656065-6656087 GAGGGCAAAGGGATTGGGAAGGG - Intergenic
1003812240 6:9796929-9796951 GAGGGGGAAGGGAGGGAGGGAGG + Intronic
1003987480 6:11451727-11451749 GAAGCTAAAGGGAAGGAGAAGGG + Intergenic
1004129013 6:12901442-12901464 GAGGAAAGAGGGAGGGAGAGAGG + Intronic
1004518914 6:16344132-16344154 GAGGGTATGGGGTTGGAGTGGGG - Intronic
1004617408 6:17303605-17303627 AAGGGAAAAGGGAAGGAGAAGGG + Intergenic
1004649325 6:17593489-17593511 GAGGGAGAAGGGAGGGAGGGAGG - Intergenic
1004689776 6:17983435-17983457 GTGGGTGAAGGGATGGAGTGGGG - Intronic
1005123164 6:22413379-22413401 CAGGGTGAAGGCATGGAGGGTGG + Intergenic
1005777618 6:29153388-29153410 AAGGGGAAGGGGAGGGAGAGGGG - Intergenic
1006021024 6:31117642-31117664 GAGAGTTTAGGGATGGAGAAAGG + Intronic
1006149515 6:31979185-31979207 GAGGGTAAAGAGGGGGGGAGAGG + Intronic
1006284440 6:33081820-33081842 GGGTGTAAAGGGATGGAGAGAGG + Intronic
1006300543 6:33191639-33191661 GAGGGCACAGGGAGGGGGAGGGG + Intronic
1006829199 6:36958610-36958632 GAGGGTAAAGGCATGGGGGCTGG + Intronic
1007079899 6:39092568-39092590 GAGGGAAAAAGGAAGGACAGAGG - Intergenic
1007521027 6:42452039-42452061 GAGGGTTAAGGGAGGGGGCGAGG - Exonic
1007663575 6:43501305-43501327 GAGGGTCAGGGGAGGAAGAGGGG - Intronic
1007734194 6:43970531-43970553 GAGGGTAATGGGAGGATGAGAGG - Intergenic
1008092615 6:47308832-47308854 GAGGGTAAAGGGATTGAGGAGGG + Intronic
1008362344 6:50635560-50635582 AAGGGGAAAGGGAGGGAGGGAGG + Intergenic
1008527466 6:52420659-52420681 GAGGGCAAAGGATCGGAGAGAGG - Intronic
1008775215 6:55030222-55030244 TAAGGTAAAGGGATGGAAAAAGG - Intergenic
1008786067 6:55169767-55169789 GAAGGTAGAGAGATGCAGAGTGG - Intronic
1008792488 6:55253877-55253899 GAGGGTAGAGGGTGGGAGAAGGG + Intronic
1008793028 6:55262109-55262131 CAGGGGAAAGTGAGGGAGAGGGG + Intronic
1009826696 6:68875225-68875247 GAGGGCAGAGGGAGGGGGAGAGG - Intronic
1010252612 6:73723741-73723763 GAGGGTAGAGGGAGGGAGGAGGG + Intronic
1010507219 6:76675401-76675423 GAGGGTAGAGGGAGGGAGGAGGG - Intergenic
1011141466 6:84162570-84162592 GAAAGTGAAGGGATGGAGAGAGG - Intronic
1011294786 6:85814902-85814924 GAGGGTAGAGGGTGGGAGAAGGG + Intergenic
1011570133 6:88725814-88725836 TAGGGGAAGGGGAAGGAGAGGGG + Intronic
1011632346 6:89339562-89339584 GAGGGAAGAGGGGTGGGGAGGGG + Intronic
1011729619 6:90247747-90247769 TTGGGTAAAGGCATGGAGATGGG - Intronic
1012537099 6:100312510-100312532 GAGAGTCAAAGGATGGAGACGGG + Intergenic
1012599431 6:101076369-101076391 GAGGGGGAAGGGAGAGAGAGAGG + Intergenic
1012735353 6:102932718-102932740 GAAAGTAAAGGGATAGGGAGAGG + Intergenic
1012986279 6:105879457-105879479 AAGGGTAGTGGGATGAAGAGGGG + Intergenic
1013153257 6:107467356-107467378 AAGGGGAAAGGGATGGAGAAAGG - Intergenic
1013216610 6:108033114-108033136 GAGGGAAGAGGGAGGGAGGGAGG - Intergenic
1013335426 6:109154266-109154288 GAGGGAAAAAGGATGAAGAGGGG - Intronic
1013417802 6:109940267-109940289 GATGGGAAAGGGGAGGAGAGAGG - Intergenic
1013456842 6:110337271-110337293 GAGGGTCGAGGGTTGGAGAAGGG + Intronic
1013571954 6:111436634-111436656 GGGGGTGCAGGGATGAAGAGAGG + Intronic
1013605824 6:111746812-111746834 GAGGGTAGAGGGAGGGAGGCAGG + Intronic
1014145005 6:117987485-117987507 GAGGGAAAAGAGATGAGGAGAGG - Intronic
1014276774 6:119397623-119397645 GAGGATAAAGGAATGTGGAGAGG + Intergenic
1014942300 6:127456950-127456972 GAGGAGAAAGGGAAGGAGGGAGG - Intronic
1014982582 6:127962581-127962603 GAGAGTAAAGGGAAGGAAAATGG - Intergenic
1015079675 6:129208704-129208726 GAAGGAAAAGGGAGGGAGGGAGG + Intronic
1015150660 6:130033101-130033123 GAAGGGTAAGGGATGGAAAGAGG + Intronic
1015517580 6:134099325-134099347 GAGTGTAATGGGATGGAGTGAGG - Intergenic
1015545955 6:134361514-134361536 CAGGGTAAGGTGATGGAGACAGG - Intergenic
1015743401 6:136483358-136483380 GAGGGTGAAGGGCGGGAGGGGGG + Intronic
1016003671 6:139067748-139067770 GAGGGGAAGGGGAGGGGGAGGGG - Intergenic
1016301486 6:142636506-142636528 GAAGGAAAGGGGATGGAGATGGG - Intergenic
1016570785 6:145509869-145509891 CAAAGTAAAGGGATGGAGAAAGG + Intronic
1017254488 6:152317518-152317540 GAGGGTGAAGGAAGGGATAGAGG - Intronic
1017293261 6:152765649-152765671 AAGGGGAAGGGGAAGGAGAGGGG - Intergenic
1017995892 6:159531418-159531440 GAGGGGAGAGGGATGCAGCGTGG + Intergenic
1018191610 6:161314360-161314382 TAGGGGAAGGGGAAGGAGAGGGG - Intergenic
1018451410 6:163911730-163911752 GAAGGGAGAGGGATGCAGAGGGG - Intergenic
1018468138 6:164071146-164071168 CTGGGTACTGGGATGGAGAGAGG + Intergenic
1018597300 6:165495346-165495368 GAGGGGAAAGGGAGAGAGAAAGG + Intronic
1018839456 6:167507925-167507947 GAGGGGACAGGGCAGGAGAGGGG - Intergenic
1018839492 6:167508024-167508046 GAGGGGAAGGGGACGGGGAGGGG - Intergenic
1018839609 6:167508296-167508318 GAGGGGACAGGGCAGGAGAGGGG - Intergenic
1018839679 6:167508490-167508512 GAGGGGACAGGGGAGGAGAGGGG - Intergenic
1018839727 6:167508622-167508644 GAGGGGACAGGGCAGGAGAGGGG - Intergenic
1018911401 6:168102341-168102363 GAGAGCAAAGAGAGGGAGAGAGG + Intergenic
1019162257 6:170076484-170076506 GACGGAGAAGGGATGGAGGGAGG + Intergenic
1019219497 6:170463000-170463022 GAGGGGGAAGTGATGGGGAGGGG + Intergenic
1019266819 7:121711-121733 GGAGGGAAAGGGGTGGAGAGGGG + Intergenic
1019328506 7:451451-451473 GAGGGGAGAGAGACGGAGAGAGG - Intergenic
1019483505 7:1277081-1277103 GAGGGAGAAGGGAGGGAGAGAGG - Intergenic
1019517545 7:1446518-1446540 GAGGGAGAAGGGGAGGAGAGGGG + Intronic
1019549251 7:1594028-1594050 GAGGAGAGAGGGATGGAGGGAGG - Intergenic
1019962625 7:4473564-4473586 CAGGGGAAAGGGAGAGAGAGAGG + Intergenic
1020983778 7:15106994-15107016 AGGGGTAAAAGGAGGGAGAGTGG - Intergenic
1021060003 7:16099497-16099519 AAGGGAAAAGGGAAGGAAAGAGG + Intronic
1021105341 7:16632104-16632126 AAGGAGAAAGGGAGGGAGAGAGG - Intronic
1021148516 7:17119958-17119980 GAGAGCAAAGGGTTGGAGAAAGG + Intergenic
1021509998 7:21425275-21425297 GAGGGGAAAGGGAGGGAGGAAGG - Intergenic
1021640393 7:22730550-22730572 GATCCTAAAGGGATGGTGAGAGG + Intronic
1021751337 7:23803720-23803742 GAGGGTAGGAGGAAGGAGAGGGG - Intronic
1021928354 7:25554580-25554602 GATGATGCAGGGATGGAGAGTGG + Intergenic
1022177638 7:27887124-27887146 GAGGGTAAAGGGTGGGAGGAGGG + Intronic
1022357049 7:29625780-29625802 GAGGGAAAGGGGAAGGAGAAGGG + Intergenic
1022532502 7:31075847-31075869 TAGGGTGAAGGGATAGAGAGTGG + Intronic
1022592898 7:31682987-31683009 GAGGGTAAAGGGAAGGGGCATGG + Intergenic
1022642513 7:32201682-32201704 GAGGATAAAAGGATGTACAGTGG + Intronic
1023116876 7:36871479-36871501 GAGGGTTAGGGATTGGAGAGGGG - Intronic
1023201489 7:37702309-37702331 GAGGGAAAAGGGAAGAAGAAAGG - Intronic
1023382764 7:39624194-39624216 GAGGGGAGAGGGGTGGAGTGAGG - Intronic
1023402877 7:39803001-39803023 GAGGGGACCGGGATGGGGAGAGG + Intergenic
1023519897 7:41039616-41039638 GTGGGAAGAGCGATGGAGAGGGG + Intergenic
1023705015 7:42932227-42932249 GAGAGTAAAGGAAAGGTGAGGGG - Exonic
1023752412 7:43385232-43385254 GAGGGGAGAGGGAAGGGGAGGGG - Intronic
1023910047 7:44547293-44547315 GAGGGGGAAGGGAAGGAGGGAGG + Intergenic
1023911133 7:44557656-44557678 GAGGGAAAAGGGAAGGGGAAGGG + Intergenic
1024250272 7:47501122-47501144 GAGGAGAAAGGGAGGAAGAGAGG + Intronic
1024673681 7:51619212-51619234 GAGGGTGAGGGGATGGAGAATGG + Intergenic
1024725438 7:52189304-52189326 GAGGGGAAGGGAAGGGAGAGGGG + Intergenic
1024725445 7:52189321-52189343 GAGGGGAAGGGAAGGGAGAGGGG + Intergenic
1024725494 7:52189439-52189461 GAGGGAAAGGGAAGGGAGAGGGG + Intergenic
1024870023 7:53954422-53954444 GAGGTTAAGGCGATGGGGAGAGG + Intergenic
1025561620 7:62379298-62379320 GAGGGCAAAATAATGGAGAGGGG - Intergenic
1025753392 7:64312441-64312463 GAGGGGAGAGAGTTGGAGAGAGG - Intronic
1025847833 7:65216734-65216756 GAAGGAAAAAGGAGGGAGAGAGG - Intergenic
1026040737 7:66865892-66865914 GGAGGTAAAGGGAGGGAGGGAGG - Intergenic
1026132085 7:67629232-67629254 TGGGGTGAAGGGTTGGAGAGAGG + Intergenic
1026494095 7:70887956-70887978 GAGGGTGGAGGGAGGAAGAGAGG + Intergenic
1026494204 7:70888445-70888467 GAGGGGGAAGAGATGAAGAGTGG + Intergenic
1026638797 7:72106647-72106669 GGGGGAAAAGGGAAGGAGGGAGG + Intronic
1026762534 7:73137696-73137718 GAAGGGAAAGGGAGGGGGAGGGG + Intergenic
1027038997 7:74947472-74947494 GAAGGGAAAGGGAGGGGGAGGGG + Intergenic
1027084690 7:75255004-75255026 GAAGGGAAAGGGAGGGGGAGGGG - Intergenic
1027143678 7:75679001-75679023 GAGGATAAACGGAGAGAGAGAGG - Intronic
1027252154 7:76405770-76405792 GAGGGCAAATGGTGGGAGAGGGG + Intronic
1027545692 7:79524794-79524816 GAGGATAAAGGGATAAAGACTGG + Intergenic
1028146702 7:87327746-87327768 GAGGGAAAAGGTAGAGAGAGGGG - Intergenic
1028631314 7:92937428-92937450 AAGGGGAAAGGAATGGAAAGAGG - Intergenic
1028782036 7:94748415-94748437 CAGAGTAAAGGGATGGTGAAAGG + Intergenic
1028793526 7:94879004-94879026 GAGGGGAAGGGGAAGGAGAGGGG + Intergenic
1028911881 7:96216745-96216767 GAGGGTAAAGGGTGGGAGGAGGG + Intronic
1028960692 7:96746673-96746695 GGGAGTAAAGTGATGGAGTGGGG - Intergenic
1029256613 7:99273766-99273788 GAGAGGAAAGGAAGGGAGAGAGG + Intergenic
1029256617 7:99273783-99273805 GAGAGGAAAGGAAGGGAGAGAGG + Intergenic
1029256623 7:99273817-99273839 GAGAGGAAAGGAAGGGAGAGAGG + Intergenic
1029256629 7:99273851-99273873 GAGAGGAAAGGAAGGGAGAGAGG + Intergenic
1029256639 7:99273898-99273920 GAGAGGAAAGGAAGGGAGAGAGG + Intergenic
1029316940 7:99724096-99724118 GAAGGTAGAGACATGGAGAGAGG - Intronic
1029432455 7:100539739-100539761 GAGGGGAAAGGGCAGGGGAGAGG + Intronic
1029538246 7:101168366-101168388 TAGGGAACTGGGATGGAGAGAGG - Intergenic
1029619618 7:101681792-101681814 CAGGGCACAGGGATGGGGAGGGG - Intergenic
1030162008 7:106518592-106518614 GAGAGGAGAGGGAAGGAGAGGGG - Intergenic
1030458755 7:109805422-109805444 GAGGGTAGAGGGGTGGAGAAGGG - Intergenic
1030694089 7:112565801-112565823 GAGGGGGGAGGTATGGAGAGAGG - Intergenic
1030741014 7:113110085-113110107 GAAGGTAAAAGGAAGAAGAGAGG + Intergenic
1030820599 7:114086867-114086889 GGGGAAAAAGGGGTGGAGAGGGG + Intronic
1030884582 7:114922335-114922357 GAGGGGAAAGAGAGGCAGAGAGG + Exonic
1030989078 7:116278479-116278501 GAGGGTAGAGGGAGGGAGAAGGG + Intergenic
1031051507 7:116950348-116950370 GAGGGGGAAGGGAAGGAGGGAGG - Intergenic
1031472206 7:122180397-122180419 GGGAGTAAAGAGATGAAGAGAGG - Intergenic
1031565116 7:123286788-123286810 GTGGGGATAGGGATGAAGAGGGG - Intergenic
1031647740 7:124247460-124247482 GAGGGTAGAGGGAAGGAGGAGGG - Intergenic
1031756135 7:125645392-125645414 GAGGGGGAAGGGAGGGAGGGAGG - Intergenic
1032058267 7:128701367-128701389 GAGGGGAAGGGGAGGGAGAGGGG + Intergenic
1032262325 7:130347439-130347461 GAAGGGAAAGGAATGGGGAGGGG - Intronic
1032436789 7:131907339-131907361 GAGGGCAAAGGGAAGGAGGGAGG + Intergenic
1032520894 7:132544244-132544266 GAGGGTTTTGGGTTGGAGAGTGG - Intronic
1032530508 7:132615843-132615865 GAGGGGAGAGGGAGGGATAGCGG - Intronic
1032540355 7:132697718-132697740 GAAGGGAAAGGGATGCAGAGGGG + Intronic
1032625003 7:133582118-133582140 GAGGGTAGAGGGAGGGAGGAAGG - Intronic
1032936713 7:136740861-136740883 GAGGGTGAAGGGTGGGGGAGAGG - Intergenic
1033118235 7:138645163-138645185 GAGGGGGAGGGGGTGGAGAGGGG - Intronic
1033496042 7:141897271-141897293 GATGGGTAAGGGATGAAGAGAGG + Intergenic
1033612500 7:142978384-142978406 GAGGGTAGAGGGTGGGAGAAAGG - Intergenic
1033619979 7:143053182-143053204 AAGGATAAAGGGATTGAGAAAGG - Exonic
1033629133 7:143139997-143140019 GAGGGCAGTGGGATGGAGAGAGG - Intergenic
1034014387 7:147566341-147566363 GAGGGGAAAGGAAGGGGGAGGGG + Intronic
1034105002 7:148482753-148482775 GGGGGTAACGGGGAGGAGAGAGG - Intergenic
1034160809 7:148993228-148993250 GGGGTGAAAGGGATGCAGAGGGG - Intergenic
1034702089 7:153105451-153105473 AAGGGAAAAGGGAAGGGGAGGGG - Intergenic
1035237651 7:157509151-157509173 GAGGGGAGAGGGAGAGAGAGGGG + Intergenic
1035237702 7:157509305-157509327 GAGGGGAGAGGGAGAGAGAGGGG + Intergenic
1035237707 7:157509322-157509344 GAGGGGAGAGGGAGAGAGAGGGG + Intergenic
1035237712 7:157509339-157509361 GAGGGGAGAGGGAGAGAGAGGGG + Intergenic
1035237717 7:157509356-157509378 GAGGGGAGAGGGAGAGAGAGGGG + Intergenic
1035237722 7:157509373-157509395 GAGGGGACAGGGAGAGAGAGGGG + Intergenic
1035237727 7:157509390-157509412 GAGGGGACAGGGAGAGAGAGGGG + Intergenic
1035237732 7:157509407-157509429 GAGGGGACAGGGAGAGAGAGGGG + Intergenic
1035237737 7:157509424-157509446 GAGGGGAGAGGGAGAGAGAGGGG + Intergenic
1035653434 8:1286576-1286598 GAGGGTATGGGCATGGAGAGGGG - Intergenic
1035776406 8:2191514-2191536 GAGGGGGAAGGGAGGGAGGGAGG - Intergenic
1035776420 8:2191544-2191566 GAGGGGGAAGGGAGGGAGGGAGG - Intergenic
1035776475 8:2191650-2191672 GAGGGGGAAGGGAGGGAGGGAGG - Intergenic
1035902409 8:3471625-3471647 GAGGAAGAAGGGAGGGAGAGAGG - Intronic
1036111467 8:5907542-5907564 GAGGAGGAAGGGATGGAGGGAGG + Intergenic
1036295198 8:7529201-7529223 GAGGGGGAAGGGAAGGGGAGGGG - Intergenic
1036327372 8:7791817-7791839 GAGGGGGAAGGGAAGGGGAGGGG + Intergenic
1036589718 8:10157825-10157847 AAAGATAGAGGGATGGAGAGAGG - Intronic
1036684787 8:10902488-10902510 GACGGAGAAAGGATGGAGAGTGG - Intronic
1036769259 8:11567410-11567432 GGGGGAAGAGAGATGGAGAGAGG + Intergenic
1037305543 8:17499383-17499405 GAGGGAAGAGGGACAGAGAGAGG - Intronic
1037447289 8:18978850-18978872 GAGGGTAGAGGGTAGGAGAGAGG - Intronic
1037467282 8:19172683-19172705 GAGGGAACGGGGATGGGGAGGGG + Intergenic
1037575264 8:20197139-20197161 GAGGGGAGATGGAAGGAGAGAGG - Intergenic
1037599471 8:20381770-20381792 GAGGGGACAGGGCTGGAGAACGG - Intergenic
1037689435 8:21170186-21170208 GAGGGAAAAGGGAAGGAGGATGG - Intergenic
1037703477 8:21295934-21295956 GAAGGGAGAGGGAGGGAGAGAGG - Intergenic
1038065459 8:23959151-23959173 GTGGGAAAGGGGATGAAGAGAGG - Intergenic
1038117692 8:24576229-24576251 CAGGGTAAAGGGAAGGGTAGTGG - Intergenic
1038189124 8:25302891-25302913 GAGTGTCAGGGGCTGGAGAGGGG + Intronic
1038407623 8:27333851-27333873 GAGGGCTAAGGGAGGGAGGGAGG - Intronic
1038735691 8:30167025-30167047 GAGAGGAAAGGGAGGGAGGGAGG + Intronic
1038750808 8:30294045-30294067 TAGGAGAAAGGGAGGGAGAGGGG + Intergenic
1038890500 8:31716765-31716787 TAGGGTAAAGTCTTGGAGAGTGG + Intronic
1039088792 8:33806246-33806268 GAGGGTAGAGGGGAGGAGAATGG - Intergenic
1039390836 8:37179810-37179832 GGGGGAAAGGGGAGGGAGAGGGG - Intergenic
1039407600 8:37326619-37326641 GAGAGGAAAGGGAAGGAGAGGGG - Intergenic
1039442534 8:37605071-37605093 GGGGGCAAAGGGAAGGAGATGGG + Intergenic
1039552334 8:38452020-38452042 GAGGGGAAGGAGAGGGAGAGGGG + Intronic
1039564678 8:38542517-38542539 GAGGGGAGGGGAATGGAGAGGGG - Intergenic
1039812653 8:41063380-41063402 AAGGGGAAAGGGAGGGAGGGAGG + Intergenic
1039971271 8:42323559-42323581 AAGAGCAAAGGGAAGGAGAGAGG + Intronic
1040457181 8:47610499-47610521 GAGGCAAAAGGGGAGGAGAGGGG - Intronic
1041304329 8:56445254-56445276 GAGAGCAAAGGGATGGAAAAGGG - Intronic
1041586773 8:59529834-59529856 GAGGGGAAAGGGAAGGGGAAGGG - Intergenic
1041800475 8:61792471-61792493 CAGGGAAAAAGGAGGGAGAGTGG + Intergenic
1041926804 8:63245446-63245468 CAGGGGAAAGGGTAGGAGAGGGG - Intergenic
1042139504 8:65663754-65663776 GAGGGGAAGGGGAAGGGGAGGGG - Intronic
1042433839 8:68741080-68741102 GAGGGTGAAGGGAGGGAGGGGGG + Intronic
1042916339 8:73878934-73878956 GATGGGAAGGGGATGGAGCGAGG + Intergenic
1043298089 8:78692193-78692215 GAGGCTAAAGGGAGGGGGAAAGG - Intronic
1043324247 8:79030681-79030703 GAGGGTAAGAGAATGGAGAGAGG - Intergenic
1043908357 8:85833143-85833165 GAGGGGAAAGGGGAGGGGAGAGG - Intergenic
1043908364 8:85833160-85833182 GAGGGGAAAGGGAAGGGGAGGGG - Intergenic
1043908372 8:85833177-85833199 GAGGGGCAAGGGAAGGGGAGGGG - Intergenic
1044184885 8:89239695-89239717 AAGGGGAAGGGGAAGGAGAGGGG - Intergenic
1044419404 8:91975984-91976006 GATGGGAAGGGGGTGGAGAGAGG + Intronic
1044559243 8:93596389-93596411 GAGAGGGAAGGGAAGGAGAGAGG + Intergenic
1044914168 8:97094551-97094573 GAATGAAAATGGATGGAGAGTGG - Intronic
1044932037 8:97260163-97260185 GAGGGGAGGGGGAGGGAGAGGGG + Intergenic
1045018023 8:98015668-98015690 CAGGATAGAAGGATGGAGAGTGG - Intronic
1045148933 8:99381039-99381061 GAGGGTGAAGGGTGGGAGAAGGG - Intronic
1045457180 8:102392281-102392303 AAAGGTAAAGGAATGGAGAATGG - Intronic
1045471606 8:102517705-102517727 GAAGGTAAAGGTCTGGAAAGAGG - Intergenic
1045628169 8:104082187-104082209 AAGGGAAAGGGGATGAAGAGAGG + Intronic
1045636138 8:104193070-104193092 GAGATTAAAGGGAAGGAGGGAGG - Intronic
1046002182 8:108434304-108434326 AAGGGTACAGGGAGGGAGGGAGG + Intronic
1046048198 8:108987982-108988004 GAGGGTAGAGGGAGGGAGGAGGG + Intergenic
1046719978 8:117608435-117608457 GAGGGAAGAGGGAGGGAGGGGGG - Intergenic
1046774013 8:118144677-118144699 GTGGGAAAAGGGAGAGAGAGAGG + Intergenic
1046851921 8:118984332-118984354 GAGGGTACAGGGTGGGAGAAGGG + Intergenic
1047487225 8:125342472-125342494 GATTTTAAAGGGATGGAAAGTGG + Intronic
1047580663 8:126211943-126211965 CAAAGTAAAGGGATGGAGAAAGG - Intergenic
1047739492 8:127795099-127795121 GATGGTCAAAGGATGGAGGGAGG - Intergenic
1047794618 8:128241921-128241943 GGGGATAAAGAGATGTAGAGTGG + Intergenic
1047880705 8:129189744-129189766 GAGGGGAAAGGGATATAGAATGG - Intergenic
1048383891 8:133893170-133893192 GAAAGGAAAGGGAAGGAGAGAGG + Intergenic
1048475748 8:134740977-134740999 GAGGGAAAAGGGAGGGAGAAAGG - Intergenic
1048781068 8:138001674-138001696 GAAGGTGTAGGGATGGAGAAGGG + Intergenic
1049071636 8:140359790-140359812 GAGGGAAAAGCCATGGAGTGTGG + Intronic
1049271906 8:141700526-141700548 GAGGGGAAGGGGAGGGGGAGAGG + Intergenic
1049370335 8:142261287-142261309 GAGGGAGGAGGGAAGGAGAGAGG + Intronic
1049397704 8:142409276-142409298 GAGTGAAAAGAGAAGGAGAGAGG + Intergenic
1049461604 8:142732069-142732091 CAGGGGAAGGGGAAGGAGAGGGG - Intronic
1049469538 8:142769218-142769240 GAGGGTTGGGGGATGGGGAGGGG + Intronic
1049524243 8:143113241-143113263 GAGAGTAAATGGATAGAAAGAGG - Intergenic
1049569545 8:143362757-143362779 GGGCTTAAAGGGAAGGAGAGGGG - Intergenic
1049737705 8:144218687-144218709 GAGGGGAGAGGGGAGGAGAGAGG - Intronic
1050013275 9:1207534-1207556 AAGGAGAAAGAGATGGAGAGAGG + Intergenic
1050140317 9:2510593-2510615 GAGGGTAGAGACACGGAGAGAGG - Intergenic
1050295315 9:4197919-4197941 GAGGGGAAAGGGAAAGGGAGAGG + Intronic
1050443700 9:5695071-5695093 CAGGGTAAGGGAATAGAGAGTGG + Intronic
1050952112 9:11610750-11610772 GAGGGGAAAGAGAAGGAGAGAGG - Intergenic
1051183859 9:14438879-14438901 GAGGGACATGGGGTGGAGAGAGG + Intergenic
1051197876 9:14583428-14583450 GAGCAAAAAGGGATGAAGAGAGG + Intergenic
1051307628 9:15731204-15731226 GGGAGGAAAGGGATGGAGAGAGG - Intronic
1051475744 9:17507130-17507152 GTGGGGAAAAGGAGGGAGAGAGG - Intergenic
1051712382 9:19945302-19945324 GAGGGGAAAAGGAAGGAGGGAGG + Intergenic
1052193078 9:25680054-25680076 AAGGGGGAAGGGATGAAGAGAGG + Intergenic
1052370852 9:27663064-27663086 GAGGGTGCAGAGATGGAAAGTGG - Intergenic
1052830930 9:33214812-33214834 AGGGATAAAGGGATAGAGAGAGG + Intergenic
1053209979 9:36219382-36219404 GAAGGAAAAGAGATGGGGAGTGG - Intronic
1053317462 9:37064116-37064138 GAGGGAAAAGGGAGGGAGGAAGG - Intergenic
1053329317 9:37188823-37188845 GAGGGAAGAGGGGAGGAGAGGGG - Intronic
1053373003 9:37578205-37578227 GAGGGGAAGGGGATAGAGAGAGG + Intronic
1053570270 9:39297124-39297146 GAGGGTAAAGGGAGGGAAGACGG + Intergenic
1053836224 9:42138079-42138101 GAGGGTAAAGGGAGGGAAGACGG + Intergenic
1054091892 9:60856134-60856156 GAGGGTAAAGGGAGGGAAGACGG + Intergenic
1054113306 9:61131724-61131746 GAGGGTAAAGGGAGGGAAGACGG + Intergenic
1054126879 9:61321882-61321904 GAGGGTAAAGGGAGGGAAGACGG - Intergenic
1054153517 9:61624269-61624291 GAGGGTGAAGGGATGCAAAAGGG - Intergenic
1054594394 9:67050445-67050467 GAGGGTAAAGGGAGGGAAGACGG - Intergenic
1054821183 9:69521854-69521876 GAGGACAAAGAGATGGAAAGGGG + Intronic
1055372851 9:75619349-75619371 GAGGGTAAAGGGTGGGAGGAGGG - Intergenic
1056101208 9:83302106-83302128 GAGGGGAGGGGAATGGAGAGAGG + Intronic
1056123491 9:83512411-83512433 GATGGTAATGTGATGGAGAGTGG + Intronic
1056130137 9:83576584-83576606 GAGGATAAAGGGTTGGAGGAGGG - Intergenic
1056195941 9:84228617-84228639 GAGGGCAATGGGACGGTGAGGGG + Intergenic
1056307904 9:85309021-85309043 GAGGGTGAAGGGTTGGAGGAGGG - Intergenic
1056810855 9:89762806-89762828 GAGGGTGAAGGGCAGGGGAGTGG + Intergenic
1057013877 9:91633105-91633127 GAGGGGAAGGGAAGGGAGAGGGG + Intronic
1057379658 9:94556077-94556099 GATGGAGAAGGGAAGGAGAGTGG + Intergenic
1057755504 9:97831817-97831839 GAGGGTAGAGGGAGAGAGAAGGG + Intergenic
1057851284 9:98568644-98568666 AAGGCCAGAGGGATGGAGAGGGG - Intronic
1057908696 9:99002062-99002084 GAGGGGAGGGGGATGGAGAAGGG - Intronic
1058234202 9:102468695-102468717 GAGGGTTGAGGCAGGGAGAGAGG + Intergenic
1058368466 9:104236063-104236085 AAGGGGAGAGGGAGGGAGAGAGG + Intergenic
1058437040 9:104972357-104972379 GAGGAGAAAGGGATGGAAGGAGG + Intergenic
1058602283 9:106683107-106683129 GATGGTAAAGGAATAGAGAATGG - Intergenic
1058640567 9:107079700-107079722 GAGGGTAGAGGAAGGGAGAGAGG + Intergenic
1058948479 9:109881028-109881050 GAGGGTGAAGGGAGGGAGGAGGG - Intronic
1059036586 9:110760560-110760582 GAGGGTAGAGGGTTGGAGAAAGG + Intronic
1059176954 9:112175989-112176011 GAGAGCAGAGGGTTGGAGAGGGG + Intergenic
1059185898 9:112270673-112270695 GAGGGTTGAAGGATAGAGAGAGG - Intronic
1059321215 9:113471598-113471620 GAGGAGAAAAGGAGGGAGAGAGG - Intronic
1059347411 9:113638931-113638953 GAGAGTTCAGGGATGAAGAGAGG - Intergenic
1059354311 9:113687356-113687378 GAGGGAAGAGGGAGGCAGAGGGG + Intergenic
1059364295 9:113773921-113773943 GAGGGAAGAGGGAGGGAGAGAGG + Intergenic
1059429629 9:114242088-114242110 GGAGGGAAAGGGATGGACAGAGG - Intronic
1059441554 9:114310116-114310138 TAGGGAAAAGGGTGGGAGAGGGG + Intronic
1059448687 9:114356476-114356498 GAGGGGACAGGGGTGAAGAGTGG - Intronic
1059591083 9:115663002-115663024 GTGGGGAAAGGGAAGTAGAGAGG - Intergenic
1059634982 9:116161446-116161468 TAAGGTGAAGGGAAGGAGAGAGG - Intronic
1059977737 9:119736129-119736151 GTAGGGAAAGGGAAGGAGAGAGG + Intergenic
1060077114 9:120601775-120601797 GAGGGTAGAGGGAGCGAGAGGGG + Exonic
1060152675 9:121298881-121298903 GAGGGTGGAGGGATGGGGATGGG + Intronic
1060465522 9:123901370-123901392 GAGGGTAGAGGGCAGGAGAGAGG - Intronic
1060554545 9:124501536-124501558 GAGGGGAAAGAGCAGGAGAGAGG + Intronic
1060674326 9:125498823-125498845 GAATGGAAAGGGAAGGAGAGTGG - Intronic
1060733202 9:126050688-126050710 GAGGGGAGAGGGCTGGAGAGCGG - Intergenic
1061036800 9:128118737-128118759 AAGGGTACAGGGATGGAGGATGG + Intergenic
1061255698 9:129453469-129453491 GAGGGTAGAGGGATGGGGAATGG + Intergenic
1061262376 9:129487422-129487444 GAGGCTTCAGGGATGGGGAGAGG + Intergenic
1061445127 9:130633319-130633341 GAGGGAAAGGGGATGGATGGTGG - Intronic
1061834171 9:133318049-133318071 GGGGGGACAGGGATGCAGAGGGG + Intergenic
1061900062 9:133668388-133668410 GAGGGTGAAGGGAGAGGGAGAGG - Intronic
1061900070 9:133668411-133668433 GAGGGTGAAGGGAGAGGGAGAGG - Intronic
1061900091 9:133668471-133668493 GAGGGGAGAGGGAGGGCGAGGGG - Intronic
1061900226 9:133668815-133668837 GAGGGGAGAGGGAGGGTGAGGGG - Intronic
1061900378 9:133669252-133669274 GAGGGGAGAGGGAGGGTGAGGGG - Intronic
1061907787 9:133707713-133707735 GAGGGGGAAGGAATGGAGACGGG + Intronic
1062143990 9:134978888-134978910 GAGGATAGAGGGAGGGAGGGAGG + Intergenic
1062163878 9:135096035-135096057 GAGGATAAGGGGAGGGAGAGGGG - Intronic
1062194242 9:135264142-135264164 GAGAGGACAGGGAGGGAGAGAGG - Intergenic
1062201708 9:135306228-135306250 GAGGGGGAAGGGAGGGAGGGAGG - Intergenic
1062212693 9:135373179-135373201 GAAGGTGCAGGGAAGGAGAGAGG + Intergenic
1185511528 X:668012-668034 GGGGGGAAGGGGAAGGAGAGGGG - Intergenic
1185534839 X:852857-852879 GAGAAAGAAGGGATGGAGAGAGG - Intergenic
1185537383 X:872962-872984 GAGGGGAAAGGGAAGGGGAAGGG - Intergenic
1185568034 X:1111628-1111650 GAGGATGAAGGGAGAGAGAGAGG + Intergenic
1185623756 X:1468792-1468814 GAGGGGAGAGGGAAGGGGAGGGG - Intronic
1185623767 X:1468816-1468838 GAGGGGAGAGGGAAGGGGAGGGG - Intronic
1185623778 X:1468840-1468862 GAGGGGAGAGGGAAGGGGAGGGG - Intronic
1185623789 X:1468864-1468886 GAGGGGAGAGGGAAGGGGAGGGG - Intronic
1185623838 X:1468981-1469003 GAGGGGAGAGGGAAGGAGAGGGG - Intronic
1185623847 X:1469005-1469027 GAGGGGAGAGGGAAGGGGAGGGG - Intronic
1185623868 X:1469056-1469078 AAGGGGAGAGGGAAGGAGAGGGG - Intronic
1185699990 X:2223574-2223596 AAGGCGAAAGGGATGGAAAGAGG + Intronic
1185708463 X:2282629-2282651 GAAGGGAAAGGGAGGGAGAGAGG + Intronic
1185751157 X:2610407-2610429 GAGGGGAGAGAGAGGGAGAGAGG - Intergenic
1185756682 X:2659254-2659276 GAGGGGGAAGGGAAGGGGAGGGG - Intergenic
1185756691 X:2659271-2659293 GAGGGGGAAGGGAAGGGGAGGGG - Intergenic
1185756700 X:2659288-2659310 GAGGGGGAAGGGAAGGGGAGGGG - Intergenic
1185756722 X:2659332-2659354 GAGGGGGAAGGGAAGGGGAGGGG - Intergenic
1185756766 X:2659420-2659442 GAGGGGGAAGGGAAGGGGAGAGG - Intergenic
1185756806 X:2659510-2659532 GAGGGGGAAGGGAAGGGGAGGGG - Intergenic
1185756815 X:2659527-2659549 GAGGGGGAAGGGAAGGGGAGGGG - Intergenic
1185756837 X:2659571-2659593 GAGGGGGAAGGGAAGGGGAGGGG - Intergenic
1185766877 X:2732769-2732791 AAGGAGGAAGGGATGGAGAGGGG - Intronic
1185914975 X:4025597-4025619 AAGGGAGAAGGGAGGGAGAGAGG - Intergenic
1186406958 X:9312952-9312974 GAAGGGAAGGGGAGGGAGAGAGG + Intergenic
1186421465 X:9430292-9430314 GAGGGGAAAGGAGTGAAGAGAGG + Intergenic
1186538273 X:10372338-10372360 GAGATTACAGAGATGGAGAGGGG + Intergenic
1186581728 X:10826925-10826947 GAGAGTAGAGGAATGGAGAGAGG - Intronic
1186666847 X:11725673-11725695 ACAGCTAAAGGGATGGAGAGAGG + Intergenic
1187103928 X:16221336-16221358 GAGGGTAGAGACATGGAGAAGGG + Intergenic
1187143887 X:16620089-16620111 GAGGGGACAGGGGTGGGGAGTGG - Intronic
1187240521 X:17508939-17508961 GAAGGTAAGGGGTTGGAGATAGG + Intronic
1187756835 X:22537383-22537405 GATAGTCAAGGGTTGGAGAGAGG + Intergenic
1188005645 X:25014106-25014128 GAGAGAAAAGGAAGGGAGAGAGG - Intronic
1188369610 X:29352615-29352637 GAGGCTAAAGAGATGGGGATGGG - Intronic
1188379259 X:29471214-29471236 GAGGGAAAAGAAAGGGAGAGAGG + Intronic
1188595347 X:31893570-31893592 AAGGGGAAAGGGAGGGAGGGAGG + Intronic
1188737051 X:33729907-33729929 AAGGGTAATGGGATGGAGAGTGG - Intergenic
1189116064 X:38343878-38343900 GCAGGAAAAGGGATGGAGAGGGG + Intronic
1189174019 X:38935877-38935899 GAAGTTAAAGGGAGAGAGAGAGG - Intergenic
1189419417 X:40843444-40843466 GAGGGTAAAGGGAAGAAGGGTGG - Intergenic
1189774822 X:44461271-44461293 GAGGGTTGAGGGTTGGAGGGAGG + Intergenic
1190116236 X:47627657-47627679 GAGGGTAATGGGATGGAGGTGGG + Intronic
1190214010 X:48468355-48468377 GAGGGTGGAGGGAAGGAGAGGGG - Intronic
1190259023 X:48786513-48786535 GAGGGAGAAGGGAGGGAGGGAGG + Intergenic
1190287952 X:48972949-48972971 GTGGGTGGAGGGATGGATAGAGG - Intergenic
1190476619 X:50834404-50834426 GAAGTTCATGGGATGGAGAGTGG - Intergenic
1191890128 X:65931565-65931587 TAGGGGAAGGGGAAGGAGAGTGG - Intergenic
1192179824 X:68909437-68909459 CAGGGTAAAAGGAAAGAGAGTGG + Intergenic
1192216830 X:69165019-69165041 GAGGGAAGAAGGAAGGAGAGGGG + Intronic
1192346866 X:70317245-70317267 GAGTCTAAAGGGAAGGAGATAGG - Intronic
1192422455 X:71045703-71045725 GAGGGGAAATGGGTGAAGAGGGG - Intergenic
1193893223 X:87077953-87077975 GAGGGTGGAGGGTTGGAGAAGGG - Intergenic
1193990994 X:88307267-88307289 GAGGGTGAAGAGAGGGAGACAGG - Intergenic
1194703383 X:97143998-97144020 AAGGGTAGGGGGATGAAGAGTGG + Intronic
1195017115 X:100790959-100790981 GAGGGTAGAGACATGGAGAAGGG + Intergenic
1195476860 X:105297053-105297075 CAGGGAAAAGGGATGGAGATTGG + Intronic
1195702141 X:107713666-107713688 GAGAGTAAAGGCAAGGAGGGGGG - Exonic
1195735001 X:108003081-108003103 CAAGGTAAAGGGTTGGAGAAAGG + Intergenic
1196874360 X:120144180-120144202 TAGGGGAAGGGGAAGGAGAGGGG + Intergenic
1197132097 X:123017427-123017449 GAGGGTGGAGGGTTGGAGAAGGG - Intergenic
1197207388 X:123801629-123801651 GAGGGGGAAAGGAAGGAGAGAGG + Intergenic
1197462459 X:126759172-126759194 GAGAGAGAAGGGAGGGAGAGAGG - Intergenic
1198204356 X:134452183-134452205 GAGGAAAAAGGGAGGGAGAGAGG + Intergenic
1198466740 X:136910210-136910232 GAGGGGAAAGAGAAGGAGATGGG - Intergenic
1199509255 X:148602040-148602062 TGGGGTAAAGTGATGGAGTGAGG + Intronic
1199547526 X:149021937-149021959 AAGGGAAAAGGGAGGGAGAAAGG - Intergenic
1199637519 X:149827168-149827190 TAGGGAAAGGGGAAGGAGAGGGG + Intergenic
1199715564 X:150505326-150505348 TAGGGTGAAGGGATGGAGGGTGG - Intronic
1200115108 X:153766483-153766505 GAGGGGGCAGGGATGGAGAGAGG - Intronic
1200839700 Y:7768459-7768481 GAGGGTTAAGGTAGGGAAAGGGG - Intergenic
1201075247 Y:10181837-10181859 GAGAGAGAAGGGAGGGAGAGAGG + Intergenic
1201105729 Y:10761971-10761993 GAGGGGAATGGAATGGAGTGTGG - Intergenic
1201136070 Y:10991077-10991099 GAGTGGAATGGGATGGAGTGAGG - Intergenic
1201431637 Y:13908602-13908624 AAGGAAAAAGGGAGGGAGAGAGG - Intergenic
1201697820 Y:16846027-16846049 CAGGGGGAAGGGAGGGAGAGGGG - Intergenic
1201702555 Y:16900472-16900494 GAGGGAAATGGGAAGGAGGGAGG - Intergenic
1201741202 Y:17326042-17326064 GAGGGAAGAAGGAAGGAGAGAGG + Intergenic
1202163644 Y:21963249-21963271 GAGGGGAGAGGGAAGGAGGGAGG - Intergenic
1202227712 Y:22623116-22623138 GAGGGGAGAGGGAAGGAGGGAGG + Intergenic
1202315445 Y:23573062-23573084 GAGGGGAGAGGGAAGGAGGGAGG - Intergenic
1202555356 Y:26097535-26097557 GAGGGGAGAGGGAAGGAGGGAGG + Intergenic