ID: 902173736

View in Genome Browser
Species Human (GRCh38)
Location 1:14633729-14633751
Sequence CTGAATCCTCAGAGAGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 448
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 407}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902173736_902173739 6 Left 902173736 1:14633729-14633751 CCATCCTCTCTCTGAGGATTCAG 0: 1
1: 0
2: 2
3: 38
4: 407
Right 902173739 1:14633758-14633780 CTGAGGCTCCTACAGTGCCTTGG 0: 1
1: 0
2: 1
3: 21
4: 278
902173736_902173740 7 Left 902173736 1:14633729-14633751 CCATCCTCTCTCTGAGGATTCAG 0: 1
1: 0
2: 2
3: 38
4: 407
Right 902173740 1:14633759-14633781 TGAGGCTCCTACAGTGCCTTGGG 0: 1
1: 0
2: 1
3: 16
4: 147
902173736_902173741 8 Left 902173736 1:14633729-14633751 CCATCCTCTCTCTGAGGATTCAG 0: 1
1: 0
2: 2
3: 38
4: 407
Right 902173741 1:14633760-14633782 GAGGCTCCTACAGTGCCTTGGGG 0: 1
1: 0
2: 1
3: 16
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902173736 Original CRISPR CTGAATCCTCAGAGAGAGGA TGG (reversed) Intronic
900527989 1:3138457-3138479 GTGAAACCTCAGAGACTGGACGG - Intronic
901771164 1:11531053-11531075 CTGGTTCCTCCGAGGGAGGATGG + Intronic
902173736 1:14633729-14633751 CTGAATCCTCAGAGAGAGGATGG - Intronic
902350537 1:15850175-15850197 CAGAATGCACAGAGGGAGGAGGG + Intronic
902774717 1:18667331-18667353 CCGCATCTTCAGAGAGTGGAAGG + Intronic
904360695 1:29969808-29969830 CTGAATTCTCACAGTGAGGGTGG + Intergenic
904377375 1:30090338-30090360 CTGCATCCCCAGAGAAAGGGAGG + Intergenic
904595631 1:31643481-31643503 TTGCATCCTTAGAGAGAGGTAGG - Intronic
905016044 1:34779675-34779697 GTGAATCATCAGTGAGTGGATGG + Intronic
905270180 1:36782450-36782472 CTGAGTGCTCAGAAAGAGAAGGG + Intergenic
905350576 1:37343632-37343654 ATGGAAGCTCAGAGAGAGGAAGG + Intergenic
905485734 1:38294892-38294914 CTGTATCCTCATATGGAGGAAGG + Intergenic
905589965 1:39154739-39154761 CTGAATCTACAGTGACAGGATGG - Intronic
905597706 1:39222577-39222599 ATTAATCCTCACAGAGAGGTAGG - Intronic
905750737 1:40461301-40461323 CAGAATCCTCAGCGACTGGAGGG + Intronic
905793660 1:40803306-40803328 CTTATTCCTCAGTGGGAGGAAGG - Intronic
907800215 1:57757421-57757443 TTAAGTCTTCAGAGAGAGGACGG - Intronic
907864562 1:58387235-58387257 GTGAACCTTCAGAGAGTGGAGGG - Intronic
908629740 1:66089567-66089589 CTGTATCCTCAGAAACAAGATGG - Intronic
909702940 1:78547979-78548001 CAGAAATCTCAGAGAGGGGAGGG - Intergenic
909972624 1:82008615-82008637 GAGAATCTTCAGAGAAAGGATGG - Intergenic
910007049 1:82410727-82410749 CTGCATCCTCACATAGTGGAAGG - Intergenic
910984210 1:92989831-92989853 CTGTGTCCTCACATAGAGGAAGG + Intergenic
912542982 1:110430990-110431012 TCTAATCCTCAGAGAGAGGTTGG - Intergenic
912938619 1:114025190-114025212 CTGAATTCCAAAAGAGAGGAGGG - Intergenic
912987668 1:114450998-114451020 CTAAATCCTAAAAGAGAGGTAGG + Intronic
913125525 1:115784148-115784170 CTGAAAGAGCAGAGAGAGGAGGG + Intergenic
914384949 1:147159535-147159557 CTGAATCCTTAGAGGCAAGAAGG + Exonic
915541730 1:156571766-156571788 TTGAATCCTAATAGAAAGGAAGG + Intronic
916610939 1:166390873-166390895 CTCAGACCTCAGAGAAAGGAAGG + Intergenic
917058692 1:171013007-171013029 CTGAAAGATGAGAGAGAGGAGGG - Intronic
919596555 1:199570838-199570860 CTGAATCCCAAAAGGGAGGAGGG - Intergenic
919639752 1:200036417-200036439 GTGAGTGCTCAGAGGGAGGAGGG + Intronic
919690648 1:200525626-200525648 CTAAATCCTCAGAGTAAGAATGG - Intergenic
919816491 1:201443986-201444008 CTGAAGCCTGAGAGAGGGGAAGG + Intergenic
920117033 1:203628583-203628605 CAGACTCCTCACACAGAGGAGGG - Intronic
921144487 1:212340193-212340215 CTGGATCCTCAGGAAGAGGATGG - Intronic
921165914 1:212507006-212507028 CTGAATCCTGAGAGTGGGGAAGG - Intergenic
921526060 1:216220224-216220246 CTGAGGCCCCATAGAGAGGAGGG - Intronic
922310781 1:224388200-224388222 CAGAATCCACAAAGAGAAGAGGG - Exonic
922501397 1:226099354-226099376 CTGTGTCCTCAAAGAGAGAAAGG + Intergenic
923965004 1:239127630-239127652 CTGTGTCCTCACAGAGTGGAAGG - Intergenic
924449538 1:244165150-244165172 CTTAATCAACAGAGTGAGGAAGG + Intergenic
1063301344 10:4851657-4851679 CTGAATCTTCACAGAAAGGTAGG + Intergenic
1064225240 10:13477922-13477944 CTGAACCCTCAGAGGGTAGAAGG - Intronic
1064543126 10:16425244-16425266 CTGAAGTCTCAGAGAGAAGCAGG - Intergenic
1064749139 10:18508369-18508391 CTGAATCCACAGAGGAAGGGAGG + Intronic
1064839297 10:19572878-19572900 CAGAGTCTTCAGAGAGAGCAGGG + Intronic
1064939088 10:20712916-20712938 CTGAATTCCAAAAGAGAGGAGGG + Intergenic
1066610252 10:37238150-37238172 GTGAATGCTCAGAGAGAAAAGGG - Intronic
1069821285 10:71230240-71230262 CTGATTGGTCAGAGTGAGGAGGG + Intronic
1069843683 10:71355922-71355944 CTGAAGCCTCAGAGACAGGGAGG - Intronic
1070943823 10:80371729-80371751 CAGAATCCACAGTGAGGGGAGGG + Intergenic
1071738881 10:88333852-88333874 CTGCATCCTCACACAGTGGAAGG - Intronic
1072976270 10:100061668-100061690 CTCCATCCTCTGAGAGAGCAAGG - Intronic
1073440119 10:103547567-103547589 CAGAATCCCCAGAGGAAGGAGGG + Intronic
1073540117 10:104311148-104311170 CGTAAGCCTCAGAGAGAGGGTGG - Exonic
1073846417 10:107560859-107560881 CTAGCTCCTCAGAGGGAGGAAGG + Intergenic
1073995099 10:109306665-109306687 CTGAATCTGCAAAGAAAGGAAGG + Intergenic
1074421383 10:113311875-113311897 CTGAATTCTCGGAGAGAGTTTGG - Intergenic
1075690424 10:124390261-124390283 CTGGAGGCTCAGAGAGCGGAAGG - Intergenic
1076587268 10:131558048-131558070 CTCAGGCCTCTGAGAGAGGAGGG + Intergenic
1076718182 10:132378430-132378452 CTGAAGTCTCAGGGAGAAGAGGG - Exonic
1077797595 11:5508358-5508380 CTGACTCCTCGGGGAGAGGCTGG + Exonic
1078395366 11:10976664-10976686 CTGACTCCTCTGGGAGAAGAGGG - Intergenic
1079018875 11:16892942-16892964 CTGCATCCTCACATAGTGGAAGG + Intronic
1079542039 11:21588134-21588156 CTTAATCCTCAGAGGGAGACTGG - Intergenic
1080740491 11:35059434-35059456 ATGAATGCCCAGAGAGAGGATGG - Intergenic
1084370668 11:68740530-68740552 CTGAAACAGCAGAGAAAGGAAGG + Intronic
1085012219 11:73149085-73149107 GTGAATCCTCAGAGTGGGGCTGG - Intergenic
1085309014 11:75505302-75505324 CTGGATCCTGAGAGGGAGGCAGG - Intronic
1085446510 11:76604397-76604419 TTGGATCCTCAGGGAGAGGCGGG - Intergenic
1086100770 11:83097188-83097210 CTGAATCCTCCGGCAGATGAAGG - Intergenic
1086170050 11:83825960-83825982 CTGAAGCATCAGTGAGAGTAGGG + Intronic
1087679334 11:101201946-101201968 GTGAGTCCTCAGAGAAAAGAAGG - Intergenic
1087991078 11:104745630-104745652 CTGAATTTACAAAGAGAGGAAGG - Intergenic
1088877711 11:113949621-113949643 CTGAATTCCGAAAGAGAGGAGGG - Intergenic
1090169267 11:124584465-124584487 CTCAATTCTCAGAGTGTGGAGGG - Intergenic
1090237787 11:125162190-125162212 CTTCATCCTCAGAGGGATGATGG + Intergenic
1090463655 11:126913430-126913452 CTCACTCTTAAGAGAGAGGATGG + Intronic
1090627768 11:128620926-128620948 CTGGAGCCTCGCAGAGAGGAGGG - Intergenic
1091276721 11:134357766-134357788 CAGCAGCCTCAGAGAGAGGCTGG - Intronic
1091647984 12:2288252-2288274 CTCACTCCTCAGAGAGAAGCTGG - Intronic
1091983674 12:4888519-4888541 CTGTATCCTCACATAGAGGAGGG - Intergenic
1092754854 12:11753665-11753687 CTGAATTACCAGAGAGAGAAAGG - Intronic
1093291362 12:17326788-17326810 TTGAATACTCAGAGATAAGAGGG + Intergenic
1093624804 12:21332490-21332512 CTGAATTCCAAAAGAGAGGAGGG + Intronic
1095715231 12:45338262-45338284 ATGAATCCTCATAAAGAGGAAGG + Intronic
1095779592 12:46044708-46044730 CTGAATTCTGAAAGGGAGGAGGG - Intergenic
1096887370 12:54731277-54731299 CTCCATCCTCAGGGAGAGGCAGG - Intergenic
1099145539 12:79039400-79039422 CTGAAACATCAGATAGATGATGG + Intronic
1100201062 12:92298293-92298315 CTGCATTCTCAGAGGGAAGAGGG + Intergenic
1100779691 12:98010688-98010710 CTGAATCCTCACATCAAGGAAGG - Intergenic
1101882022 12:108632132-108632154 GTTAAACCTCAGAGAGCGGAAGG - Intronic
1102122358 12:110451554-110451576 AGGAAACCTCAGAGAGAGGATGG - Intergenic
1103301150 12:119927426-119927448 CTGCATCCTCAGACGGTGGAAGG - Intergenic
1103587955 12:121970195-121970217 ATGAACCCTGAGAGAGGGGATGG - Intronic
1103602507 12:122063276-122063298 CAGAAGCCTTAGAGAGAGGAGGG - Intergenic
1104305491 12:127607336-127607358 CTGAATCCGCAGGGAGAGTCTGG - Intergenic
1104423267 12:128654372-128654394 CTGCAGCCTCAGAGGGAGCACGG + Intronic
1104947688 12:132423919-132423941 CTGGATCCACAGAGAGAACATGG + Intergenic
1106401821 13:29438506-29438528 CTGTATCCTCACACGGAGGAAGG + Intronic
1106505708 13:30368917-30368939 CTGAAGCCTCAGAGAAGAGATGG - Intergenic
1107408137 13:40134303-40134325 CCAAGTCCTGAGAGAGAGGAGGG - Intergenic
1107440478 13:40422980-40423002 CAGACTCCCCAGAGGGAGGAGGG - Intergenic
1107557837 13:41533380-41533402 CTGAAGCCGCAGTGAGAGGGAGG + Intergenic
1107982867 13:45750187-45750209 ATGAACCTTCAGAGAGTGGAGGG - Intergenic
1108334729 13:49427883-49427905 CTGTATCCTCACATAGTGGAAGG + Intronic
1108905341 13:55463872-55463894 CTTAAACCTTAGAGAGAGGAAGG - Intergenic
1111925295 13:94457375-94457397 CTGCATCCTCATATAGTGGAGGG - Intronic
1112916889 13:104562443-104562465 CTGAGACCTCCCAGAGAGGAGGG - Intergenic
1113328439 13:109306314-109306336 CTGAAAACTCAAAGAGAGGAAGG + Intergenic
1113404404 13:110024421-110024443 CTGCTTCCTCTGAGAGGGGACGG - Intergenic
1114215920 14:20657794-20657816 GTGGATGCTCAGGGAGAGGAAGG - Intergenic
1114570047 14:23660579-23660601 CTCACTGCTCAGACAGAGGAAGG - Intergenic
1114697708 14:24643364-24643386 CTGAGTCCTCAGAGTGTGAAAGG + Intergenic
1114990627 14:28283548-28283570 TTAAATACTCAGAGACAGGAAGG + Intergenic
1116611155 14:47073901-47073923 CGGCATCCTCAGAGACAGGTGGG - Intronic
1117573918 14:57078588-57078610 TTGTATCCTCACAGAGGGGAGGG - Intergenic
1118075864 14:62298239-62298261 CTTATTCTTCAGATAGAGGAAGG - Intergenic
1118389231 14:65282244-65282266 CTGTAATCTCAGAGAGAGGATGG - Intergenic
1118395130 14:65329754-65329776 CTGAATACTCAAAGAGAGGAAGG + Intergenic
1119325012 14:73754683-73754705 CTGGGGCCTCAGACAGAGGAAGG + Intronic
1119457752 14:74770698-74770720 CTGAAAGCTCAGGGTGAGGATGG + Intronic
1119630356 14:76226691-76226713 CTGCATCCTCACACAGCGGATGG - Intronic
1121240694 14:92427933-92427955 CTGCATCCTCACACAGTGGAAGG - Intronic
1121286900 14:92743097-92743119 GTGAAGGCCCAGAGAGAGGAAGG - Intronic
1121319684 14:92984333-92984355 GAGAAGCCTCAAAGAGAGGAGGG + Intronic
1121614535 14:95304365-95304387 CTGCATCCTCAGTGACAGCAAGG + Intronic
1121861669 14:97324433-97324455 CTGAATCAGCAGAAACAGGAAGG - Intergenic
1125038396 15:35154009-35154031 CTAGATCTCCAGAGAGAGGAAGG + Intergenic
1125987397 15:44067580-44067602 CTGCATCCTCAGAGGGTGGAGGG + Intronic
1126107264 15:45154879-45154901 CTGGATCCCCTGTGAGAGGAGGG + Intronic
1126373386 15:47970468-47970490 CTGAGTCCTCAGAGACAGTCAGG + Intergenic
1126919911 15:53509607-53509629 CTGAAGCCTCATTGAGATGATGG - Intergenic
1127999980 15:64181910-64181932 CTGAATAGTCATAAAGAGGAGGG + Intronic
1128347212 15:66862051-66862073 GAGAAACCTCAGAGAGGGGAAGG + Intergenic
1128613250 15:69090281-69090303 CTGAATTGTCTGAGAGAGGGAGG - Intergenic
1129063220 15:72878262-72878284 CTGTATCCTCACATGGAGGAAGG + Intergenic
1129114941 15:73360075-73360097 CTGCATCTTCAGAAAGGGGAAGG + Intronic
1130865558 15:87930487-87930509 CTCACTCCTCAGAAGGAGGAAGG + Intronic
1131001944 15:88946056-88946078 CTGAATCTTCAGAGGGTGAAGGG - Intergenic
1131994688 15:98122754-98122776 ATGAAGACTCAGAGAGAAGATGG - Intergenic
1132305431 15:100808395-100808417 CTGCAGCCTCACAGAGAGCAAGG + Intergenic
1132851998 16:2028988-2029010 CTGGATCTGCAGAGAGGGGAAGG - Intronic
1133315492 16:4881133-4881155 CTTGACCCTCAGAGAGATGAAGG - Exonic
1133813932 16:9182138-9182160 CTAAGTCTTCAGAAAGAGGATGG - Intergenic
1134145104 16:11754491-11754513 CTGAATCAACAGAGAGACGGAGG + Intronic
1134395608 16:13860132-13860154 CTGAGTCCTGAGAGACAAGAAGG - Intergenic
1134437030 16:14269067-14269089 CTGCATCCTCACAAAGAGGAAGG + Intergenic
1135132847 16:19867165-19867187 CTGACACCTCAGTGAGATGAGGG + Intronic
1135851467 16:25967765-25967787 CTGGAACCTCTGGGAGAGGAGGG + Intronic
1139253204 16:65516549-65516571 CTGAATCCTCAGCGGGGTGAAGG + Intergenic
1139441854 16:66972339-66972361 CAGAATCTACAGAGAAAGGATGG - Exonic
1139939667 16:70596157-70596179 CTGTAGCCTCAGAGGCAGGAGGG + Intronic
1140132200 16:72173121-72173143 ATGAAGCCTCAGAGATATGAAGG - Intronic
1141405942 16:83793132-83793154 CAGAAGCCTGAGAGTGAGGAAGG + Intronic
1142623020 17:1176967-1176989 AACAATGCTCAGAGAGAGGAAGG + Intronic
1142824091 17:2496844-2496866 CTGCATCCTCACAGGGTGGAAGG - Intronic
1143254850 17:5548390-5548412 CTCTATCCTCAGAGGGAGGAGGG - Intronic
1143974042 17:10816873-10816895 CTGCAGCCTCAGAGATAGGAGGG + Intergenic
1144085407 17:11803876-11803898 CTGAATCAGGAGAGAGAGGCTGG + Intronic
1146110772 17:30087047-30087069 CTGAATCCTTGAAAAGAGGAAGG - Exonic
1146602257 17:34227972-34227994 CTGAATTCTGAAAGAGAGAAGGG - Intergenic
1146955233 17:36933397-36933419 CTGGAACCGAAGAGAGAGGAGGG + Intergenic
1147389311 17:40099545-40099567 GGGAATCCTCAGTGACAGGAGGG - Intronic
1149223741 17:54444392-54444414 CTGTATTCTAAGAGTGAGGATGG - Intergenic
1149615472 17:57993950-57993972 ATGAATGCTCAGAGAGCAGATGG + Intronic
1150988263 17:70224524-70224546 CTAAAAATTCAGAGAGAGGAAGG - Intergenic
1152307170 17:79527925-79527947 CTGACTCGGCAGAAAGAGGAAGG - Intergenic
1153361463 18:4202340-4202362 CTGGAGCCTCAGAATGAGGAAGG + Intronic
1154049558 18:10941214-10941236 GGGAATCCTTAGAGAGAGTAAGG + Intronic
1154398930 18:14016667-14016689 CTGCATCCTCACACAGTGGAAGG + Intergenic
1158617484 18:59001584-59001606 CTGAATTCTGAAAGGGAGGAGGG + Intergenic
1158676941 18:59529041-59529063 CAGATTCCTCAGAGACAGCAAGG + Intronic
1159030179 18:63222990-63223012 CTGAATCCTCAGTGAGGAGCAGG + Intronic
1159494038 18:69177318-69177340 CTTCAGCCTCAGAGAGAGGCTGG + Intergenic
1160043592 18:75367447-75367469 TAGAACCTTCAGAGAGAGGAGGG - Intergenic
1160057686 18:75500049-75500071 CTGTTTCCACAGAGAAAGGAAGG - Intergenic
1160257582 18:77260254-77260276 CTGTATCCTCACAGAGTGGAAGG + Intronic
1161476962 19:4491527-4491549 CTGAATGCTCAGTGATGGGAAGG - Intronic
1161540293 19:4846752-4846774 GTGAATACACAGAGAGAAGATGG + Intronic
1161908187 19:7173243-7173265 CTGAATACTCACAGTGAGTAAGG - Intronic
1163233614 19:16019218-16019240 CTGAATCCTCAGAGACCTGCTGG - Intergenic
1163626435 19:18392593-18392615 CAGCCTCCTCAGAGAGAGGTGGG - Intronic
1164161345 19:22627390-22627412 ATGAATCCTCATGGGGAGGAAGG + Intergenic
1164479400 19:28599744-28599766 ATGAATTCTCTGGGAGAGGAAGG + Intergenic
1164606012 19:29598646-29598668 CTGAAGCCTCAGACAGCTGAGGG + Intergenic
1164613616 19:29650907-29650929 CTGAATTCCAAGAGGGAGGAGGG + Intergenic
1164789966 19:30968435-30968457 CTGAGCCTTCAGAGAGAGCATGG + Intergenic
1165361123 19:35337698-35337720 GGGAATCCTCAGAGGGTGGAGGG - Intronic
1168485696 19:56760169-56760191 TTGGATGCTCAGAGACAGGATGG + Intergenic
926800643 2:16657094-16657116 CTTAATTCTCAGAGAGACAAAGG + Intronic
928844130 2:35648713-35648735 CTGTATTCTCACAGGGAGGAAGG + Intergenic
929271938 2:39982223-39982245 CTGAAGACTCAGAGAAAGGCTGG + Intergenic
929565563 2:42981944-42981966 CTGTGTCCTCAGACAGTGGAAGG + Intergenic
930019682 2:46994047-46994069 CTGAATACTCAGAGTGGGGCTGG + Intronic
930035921 2:47084951-47084973 ATGAGGCCTGAGAGAGAGGAGGG + Intronic
930641509 2:53859200-53859222 CCTAATCCTCACAGAGAGCAAGG + Intronic
932720714 2:74137390-74137412 CTGAAAGCTCAGAGAGAGAGAGG + Intronic
933917258 2:87008207-87008229 TTGAATCCTGAAACAGAGGAAGG - Intronic
934005738 2:87761707-87761729 TTGAATCCTGAAACAGAGGAAGG + Intronic
934473477 2:94576891-94576913 CAGGAGCATCAGAGAGAGGAGGG + Intergenic
934810942 2:97276090-97276112 TGGAATCCTCAGAGTGAGCAGGG - Intergenic
934826750 2:97431849-97431871 TGGAATCCTCAGAGTGAGCAGGG + Intergenic
935768694 2:106395807-106395829 TTGAATCCTGAAACAGAGGAAGG + Intronic
935911406 2:107900121-107900143 TTGAATCCTGAAACAGAGGAAGG - Intergenic
935969522 2:108516961-108516983 TTGAATCCTGAAACAGAGGAAGG - Intergenic
936133189 2:109865179-109865201 TTGAATCCTGAAACAGAGGAAGG - Intergenic
936211508 2:110506306-110506328 TTGAATCCTGAAACAGAGGAAGG + Intergenic
936420646 2:112360881-112360903 TTGAATCCTGAAACAGAGGAAGG + Intergenic
936896372 2:117432506-117432528 CTGTGTCCTCAGATAGTGGAAGG + Intergenic
937282785 2:120731751-120731773 CTGAGTCCTCACATGGAGGAAGG - Intergenic
937677537 2:124608429-124608451 CTGCATGCTCAGATAGAGGCAGG - Intronic
939681911 2:145146750-145146772 CTAAATCCACAGGGAGAGGTTGG - Intergenic
940956461 2:159733637-159733659 CTGAAGCTTCAGAGAAAAGAGGG + Intronic
941873746 2:170412448-170412470 CTGAGTCTTCAGACAGAAGAAGG - Intronic
944783734 2:203046656-203046678 CTGTGTCCTCACACAGAGGAAGG + Intronic
946081658 2:217125319-217125341 CTGTTTACTCAGAGAGAGGAAGG + Intergenic
946285845 2:218701900-218701922 CTGATTCCCCAGAGAGAGCAAGG - Exonic
946543176 2:220707999-220708021 CTGACTCCATAGAGAGATGAAGG - Intergenic
946965689 2:225035075-225035097 CTGAGTCTTCAAAGAGAGAAGGG + Intronic
947569032 2:231216553-231216575 AAGGAGCCTCAGAGAGAGGATGG + Intronic
947874527 2:233459514-233459536 CTGACTGCTCAGTGAGGGGATGG + Intronic
948161319 2:235827290-235827312 CTGAAACCTCAGGGTGAGCAAGG - Intronic
948711212 2:239826912-239826934 CTGAGTGCACGGAGAGAGGAAGG - Intergenic
1169208005 20:3750609-3750631 CTAAATCCTCTGAGTGAGTAGGG + Intronic
1170290703 20:14765262-14765284 GTGTGTCCTCAGAGAGAGTAAGG - Intronic
1170823772 20:19776206-19776228 CTGAATTCCCAAAGGGAGGAGGG - Intergenic
1172436337 20:34931338-34931360 CTAAAGCCCCAGAGAGAGGGTGG - Exonic
1172571811 20:35976387-35976409 CTGAATTCTCTGAGAGATGCTGG + Intronic
1172620432 20:36315320-36315342 CTGAGACCTGAGAGTGAGGAGGG + Intronic
1172832219 20:37845682-37845704 CTGCAACCTCAGAGAGAAGACGG - Intronic
1173106503 20:40141833-40141855 CTGAATCCACAGGGTAAGGAGGG + Intergenic
1173495079 20:43513047-43513069 CTGAATCCCCAGAGGGAGGAGGG + Intronic
1174301553 20:49585906-49585928 CAGAATCCAGAGAAAGAGGAAGG + Intergenic
1177214394 21:18109632-18109654 CTGAATCTCCAGAAAGATGAGGG - Intronic
1178945012 21:36939716-36939738 GGGAACCCTCAGAGAGAGCATGG - Intronic
1179496546 21:41775475-41775497 ATGAACCCTCTGAGAGAGGGTGG - Intergenic
1179569833 21:42272226-42272248 TTGAATCCTCAGAGTGAGGCAGG + Intronic
1182067327 22:27439828-27439850 CTGCAGCCCCAGAGAGTGGATGG + Intergenic
1183113976 22:35675408-35675430 CTGAATTCCAAAAGAGAGGAGGG - Intergenic
1183545442 22:38452806-38452828 CTGGCCCCTCAGAGTGAGGAGGG - Intronic
1183620702 22:38970610-38970632 CTGAATCCTGAGGGAGAGAAGGG - Intronic
1183624651 22:38994197-38994219 CTGAATCCTGAGGAAGAGAAGGG - Intergenic
1184999837 22:48238617-48238639 CTGAAGCCTGAGAGGGAGAATGG + Intergenic
949111969 3:271742-271764 GAGAAACCACAGAGAGAGGAAGG + Intronic
949240414 3:1864797-1864819 CTGGATCCTGAGACAGAAGATGG - Intergenic
949406229 3:3717600-3717622 TGGAGTCCTCAGAAAGAGGATGG + Intronic
949806032 3:7956823-7956845 CTGTGTCCTCACATAGAGGATGG + Intergenic
950187179 3:10952381-10952403 ATGAACCCTCAGAGGAAGGAGGG + Intergenic
950764918 3:15266508-15266530 TTTCATCCTCTGAGAGAGGAGGG - Intronic
951681094 3:25295364-25295386 CTGCATCCTCACATAGTGGAAGG - Intronic
954392507 3:50274996-50275018 CCGAGTCCTGAGAGGGAGGAGGG - Exonic
955200896 3:56851249-56851271 CTGAATCCACAGTGCTAGGAGGG - Intronic
955807752 3:62755097-62755119 CTGAGACTTCAGAGAGGGGAAGG + Intronic
956072310 3:65466582-65466604 CTGACTCCACAGGGAGAGGGTGG + Intronic
956289673 3:67648289-67648311 CTGAAGCCAGAGAGAGAGGAAGG + Intronic
956747786 3:72323289-72323311 CTGTGTCCTCACAGAGTGGAAGG + Intergenic
957121121 3:76094293-76094315 CTTAATCCTCAGAAGCAGGAAGG + Intronic
957208989 3:77236411-77236433 CTGAAATCTGAAAGAGAGGAGGG + Intronic
957923701 3:86780111-86780133 CTGCATCATCGGATAGAGGAAGG + Intergenic
957954126 3:87161577-87161599 ATGAATCCTCAGAGCTAGAAGGG - Intergenic
958119134 3:89262350-89262372 TAGAATCCTCAGAGGGAGTATGG - Intronic
959158519 3:102695844-102695866 GTGAACCTTCAGAGAGAGGAGGG - Intergenic
959965323 3:112347479-112347501 CAGTCTCCTCAGAGAGATGAAGG - Intronic
960323175 3:116262941-116262963 CTGAGTGCTCAGTGAGAAGAAGG + Intronic
960372144 3:116853546-116853568 CTAAATGCTCAAATAGAGGAAGG - Intronic
960460026 3:117922256-117922278 CTGAATACTCAAAGGGAGGAGGG - Intergenic
960470997 3:118065126-118065148 CTGCATCCTCACAGAGCAGAAGG + Intergenic
960509716 3:118534493-118534515 ATGGAGCCTCAGAGAGATGATGG + Intergenic
960727020 3:120680864-120680886 CTGAGTCTTCAGAGAGAAGTTGG - Intronic
962040910 3:131706616-131706638 CTGAATCCCAAAAGGGAGGAGGG - Intronic
962436019 3:135367351-135367373 CTGAGGCCTCAATGAGAGGAAGG + Intergenic
962728616 3:138258855-138258877 CTGAATCCTCAGAGTGGAGGAGG - Intronic
964760788 3:160133439-160133461 CTGAGTCCCCATAGAGGGGATGG + Intergenic
967750990 3:193116114-193116136 CTGCATCCTCACATAGTGGAAGG - Intergenic
967863245 3:194169366-194169388 CTGAACCCACAGAAAGAGAATGG - Intergenic
967890442 3:194360789-194360811 CTCAATCCTCAGGGCGATGAGGG + Exonic
968036583 3:195553055-195553077 CTGGAGTCTCAGAGGGAGGATGG - Intergenic
968621559 4:1605587-1605609 CTGGACCCGCAGGGAGAGGAGGG - Intergenic
968746443 4:2362911-2362933 CCGAGTCCTGAGAGAGAGCAGGG - Intronic
969260925 4:6033001-6033023 CTGAACCCTCAGAGAGGGTCAGG + Intronic
970105026 4:12572537-12572559 ATGATTCAACAGAGAGAGGAAGG - Intergenic
970449052 4:16149008-16149030 CTTAATCCTCACAGCAAGGAGGG - Intergenic
972170958 4:36344663-36344685 CTGAATTCCAAAAGAGAGGAGGG + Exonic
972936356 4:44140837-44140859 CTGCATCCTCACATAGTGGAAGG + Intergenic
974439673 4:61899816-61899838 CTGAATCCTCACATGGTGGAAGG + Intronic
975735093 4:77373068-77373090 CTCAATCCCCAGAGTAAGGAGGG + Intronic
978233916 4:106434144-106434166 CTGAATCCCAAGAGAGTAGAAGG - Intergenic
978760190 4:112348977-112348999 CTGACACCTCAGACAGAGGCAGG + Intronic
979399085 4:120225649-120225671 CTGCATGCTCACAGAGCGGAGGG + Intergenic
979458309 4:120951379-120951401 CTGAGTCCTCAGACAGTGGAGGG + Intergenic
979724207 4:123941542-123941564 CTGAAACCTCAAACAGAGGCTGG + Intergenic
979742435 4:124168067-124168089 CGGATTCCTCAGAGACAGCAAGG - Intergenic
980208089 4:129748214-129748236 CTGAATCCTCACTTAGCGGAGGG - Intergenic
980636232 4:135507783-135507805 CAGAATCTTCAGAGAAAGCATGG - Intergenic
981073075 4:140565588-140565610 GTGAAGCCACAGAGACAGGAGGG - Intronic
983301215 4:165928422-165928444 GTAAGTCCTCTGAGAGAGGATGG + Intronic
985523584 5:390767-390789 CTAAATGCTCCCAGAGAGGAGGG + Intronic
985558215 5:568495-568517 CTGAAACCCTAGAGAGAGGAGGG - Intergenic
986011336 5:3718602-3718624 CTGAAGACCCAGAGAGAAGATGG + Intergenic
986342649 5:6804189-6804211 GTGGATCCTCAGAGAGGGCATGG - Intergenic
987828318 5:23062525-23062547 CTGCATCCTCATATAGTGGAAGG + Intergenic
989456319 5:41648346-41648368 GTGAAACCTCAGAGAGAAGGTGG + Intergenic
989797215 5:45490472-45490494 AAGAATGCTCAGAAAGAGGAAGG - Intronic
989961753 5:50424429-50424451 CTCCATTCTTAGAGAGAGGAAGG + Intronic
990966374 5:61452794-61452816 CTAAATCCTCAAAGAGAAAAAGG - Intronic
990990471 5:61678739-61678761 GTGACTCTTCAGAGAGAGGCAGG + Intronic
992085316 5:73273138-73273160 CTGAATCCACAGATGGAGGAGGG - Intergenic
992391888 5:76337239-76337261 CTGAAGACACAGAGAGAAGATGG - Intronic
992734766 5:79707938-79707960 CTGAGTCCTCACACAGTGGATGG + Intronic
993155027 5:84211712-84211734 TAGAACCCTCAGAGAGAGCATGG + Intronic
993164584 5:84335927-84335949 CTGTTTCCTCAGATGGAGGAAGG + Intronic
993295396 5:86132570-86132592 CTACATCCTCACAGAGTGGAAGG - Intergenic
993834375 5:92798615-92798637 CCGAAACCTCAGAGAGAGTGAGG - Intergenic
995597384 5:113762662-113762684 CTGTGTCCTCAAATAGAGGAAGG + Intergenic
995682207 5:114732277-114732299 CCAAATTGTCAGAGAGAGGATGG - Intergenic
995904281 5:117104926-117104948 ATGAACCCTCAGGGAGATGATGG + Intergenic
996318020 5:122183104-122183126 CAGAAAGCTCAGGGAGAGGAAGG - Intergenic
996827654 5:127703486-127703508 CTGACACCTCAGAGAGAAGCAGG + Intergenic
997089309 5:130838493-130838515 CTGAATCCTCAAATGGTGGAAGG + Intergenic
997412910 5:133703815-133703837 GGAAAGCCTCAGAGAGAGGAGGG + Intergenic
997831727 5:137156166-137156188 CTGAACCCTGAGAGTGGGGAGGG + Intronic
999320909 5:150614476-150614498 CTGACCCCTCAGAGGGAGCAGGG + Intronic
1000756963 5:165173455-165173477 CTGAATCCTCACATAAAGGAGGG - Intergenic
1001477429 5:172060490-172060512 CTGTATCCTCACATAGTGGAAGG - Intronic
1001806254 5:174589368-174589390 TTGATTCCTGAGACAGAGGATGG + Intergenic
1001885247 5:175284386-175284408 CGGAGTCCTCAGAGAGATCATGG + Intergenic
1004294717 6:14400218-14400240 CTGTATCCTGGGAGGGAGGATGG - Intergenic
1004466154 6:15887230-15887252 CAGAAACCTCAGTGAAAGGAGGG + Intergenic
1004481185 6:16020833-16020855 CAGAAGCCAGAGAGAGAGGAGGG - Intergenic
1005454224 6:26003653-26003675 CTGGAAACTCAGAGAGATGATGG + Intergenic
1005522004 6:26609967-26609989 CTAAATGGGCAGAGAGAGGATGG + Intergenic
1006040225 6:31246423-31246445 CTGAATCAACAGACAAAGGAAGG - Intergenic
1007320009 6:41021293-41021315 CTGAATCCTCAGTGAGTACACGG - Intergenic
1010000326 6:70942394-70942416 CTGAATACTCAGAGACCTGAAGG - Intronic
1010025360 6:71209389-71209411 CTGAATCTAGAGAGACAGGAGGG + Intergenic
1010443023 6:75919982-75920004 CTGGGTCCTCTGAGAGTGGAAGG + Intergenic
1011338960 6:86291437-86291459 ATGCATCCTGAGAGAGAGAAAGG - Intergenic
1012684540 6:102228831-102228853 CTGAATCCTCAGAGCAAGTTGGG + Intergenic
1013759386 6:113499188-113499210 ATGCATCCTCACATAGAGGAAGG + Intergenic
1015156853 6:130106355-130106377 TTGAAACCCCAGAGAGAGGATGG - Intronic
1016599424 6:145841275-145841297 CTAAATCCTCACACGGAGGAAGG + Intergenic
1016980100 6:149846095-149846117 CTTCATCCGCAGTGAGAGGAAGG + Intronic
1017057212 6:150448377-150448399 ATGAGTCATCAGAGAGAGGTTGG - Intergenic
1017238051 6:152137949-152137971 CTGAGACCTCAGAGAGATTAGGG - Intronic
1017731337 6:157319517-157319539 CTGAATAAACAGAAAGAGGAAGG - Intronic
1017807644 6:157959938-157959960 CTGCATCCTCACATGGAGGAAGG - Intergenic
1018782194 6:167078298-167078320 CTGCATCCTCACAGGGAGAAGGG + Intergenic
1019214478 6:170434463-170434485 GTGAATCCTCAGCCACAGGATGG - Intergenic
1020855181 7:13411847-13411869 CTGAAACCTCAGGGACAGAAGGG - Intergenic
1021387200 7:20045664-20045686 GTGTAACCTGAGAGAGAGGAGGG - Intergenic
1022647104 7:32241821-32241843 CTGTATCCACAGAGAGGAGATGG + Intronic
1023174480 7:37422493-37422515 CTGAATCCTCTAAGAGAAGCAGG - Intronic
1023810528 7:43907723-43907745 TTTAATCTTCACAGAGAGGAAGG - Intronic
1024509289 7:50190508-50190530 CTGAACCCTCAGAGGGTGGTGGG + Intergenic
1026797458 7:73375626-73375648 CTGAATCAGCAGAGAGGAGAAGG + Intergenic
1028662432 7:93295289-93295311 CTGTATCCTCAAATAGTGGAAGG + Intronic
1028713573 7:93938653-93938675 CTGCAACCAAAGAGAGAGGAAGG - Intergenic
1029489203 7:100861278-100861300 CTGTGTCCCCAGAGAGAAGAAGG + Intronic
1030365271 7:108638767-108638789 CTGACTCCTCAGAGAGTCTAAGG - Intergenic
1031489181 7:122366759-122366781 CTGGATTCACAGAAAGAGGATGG - Intronic
1031937151 7:127747352-127747374 ATGATTCCTCAGAGAGACAAGGG - Intronic
1032860837 7:135877847-135877869 CTGAATAATCAGAGAAAGGAGGG - Intergenic
1033558871 7:142512055-142512077 CTGAATCGTCAGAGTGGAGATGG - Intergenic
1034203842 7:149298994-149299016 CTGGATCATCAGGGACAGGATGG - Intergenic
1034214341 7:149393629-149393651 CTGTATGCTCACAGAGTGGAAGG + Intergenic
1034745885 7:153523760-153523782 GTGAAGACTCAGAGAGAAGACGG - Intergenic
1034790685 7:153965031-153965053 CTGAATTCTGAGAGAAAGAAAGG - Intronic
1034822133 7:154225851-154225873 CTGACTCCACAGAGAGAGGGTGG - Intronic
1035132708 7:156670312-156670334 CTGACTCCTCAGTGAGCTGAAGG - Intronic
1035455474 7:159006140-159006162 CTGCTTCCTCAGGAAGAGGACGG + Intergenic
1035455527 7:159006368-159006390 CTGCTTCCTCAGGAAGAGGACGG + Intergenic
1035455554 7:159006482-159006504 CTGCTTCCTCAGGAAGAGGACGG + Intergenic
1035969632 8:4233544-4233566 CTGTGTCCTCAGACAGTGGAAGG - Intronic
1036767252 8:11556856-11556878 CCGCATCCTCAGAGCGAGGCGGG + Intronic
1037305552 8:17499419-17499441 CTGAACACACAGAGAGAGAAGGG - Intronic
1037626799 8:20615255-20615277 CTGTGTCCTCACAGAGTGGAAGG + Intergenic
1038184189 8:25258092-25258114 CTGGAAGCTCAGTGAGAGGAAGG - Intronic
1040983553 8:53269516-53269538 TTGAATCCTCAGGGAGGAGAGGG + Intergenic
1041459036 8:58091490-58091512 TGGAATCCTGAGAGACAGGAGGG - Intronic
1041804808 8:61838462-61838484 GTGAACCTTCAGAGAGTGGAGGG - Intergenic
1043586376 8:81774302-81774324 CTGAAGCCTCAGAGAGATTAAGG - Intergenic
1045548346 8:103148305-103148327 CTGGAAGCTCAGAGAGAGGCAGG + Intronic
1045724202 8:105151960-105151982 CTGAATCATCAGTTAGAGAAGGG - Intronic
1046264051 8:111807789-111807811 CTGTGTCCTCACAGAGTGGAAGG + Intergenic
1046358204 8:113115943-113115965 CTGTGTCCTCACATAGAGGAAGG - Intronic
1046852016 8:118985113-118985135 CTGTACCCTCAGAGAGAGCATGG + Intergenic
1047193544 8:122700495-122700517 CTGAAGACACAGGGAGAGGATGG + Intergenic
1047344505 8:124014033-124014055 GTGAGCCTTCAGAGAGAGGAGGG - Intronic
1047482117 8:125293705-125293727 CTGAATGCTGTGAGAGATGATGG + Intronic
1047953308 8:129953615-129953637 CTGTATCCCCAGTGAGAGCACGG + Intronic
1048320361 8:133395072-133395094 CTGTGTCCTCACAGAGTGGAAGG - Intergenic
1048579569 8:135719892-135719914 CTGACTCCTCTGACACAGGAGGG - Intergenic
1048943079 8:139419339-139419361 ATGAATACTCAGGGAAAGGACGG + Intergenic
1049576316 8:143391566-143391588 CTGATCCCTCACAGAGAGGCAGG + Intergenic
1050766741 9:9143742-9143764 ATCCATCCTCAGAGAGAGGAAGG + Intronic
1051508238 9:17848384-17848406 CTGAATTCTCAGATTGTGGAAGG - Intergenic
1051699551 9:19806871-19806893 CTGAATCTGCAAAGAAAGGAGGG - Intergenic
1053377795 9:37622660-37622682 CTGAATCATAACAGAGATGATGG - Intronic
1053378638 9:37630002-37630024 CTGTATCCTCATGGAGTGGAAGG + Intronic
1054380922 9:64488492-64488514 CTGAATCCTTGGAGAGAAAAAGG + Intergenic
1054777596 9:69136920-69136942 CTGCTTCCTCGGAGACAGGAGGG - Intronic
1055113291 9:72580934-72580956 CTGAAACCTCTGACTGAGGATGG - Intronic
1057001990 9:91518636-91518658 CTGAAGCCTGCGAGAGGGGATGG + Intergenic
1057077067 9:92143503-92143525 CTGAGTCTTGAGAGAGAGGGGGG - Intergenic
1057339539 9:94187549-94187571 CTGCATCCTCACATAGTGGAAGG + Intergenic
1057707802 9:97409881-97409903 CTGAATCCTTACACAGTGGAAGG + Intergenic
1058530320 9:105899995-105900017 CTGATTCCTCAGAGCCAGCAGGG + Intergenic
1059258777 9:112955933-112955955 CTGGAGTCTCAGAGAGAGGCTGG - Intergenic
1059309841 9:113380741-113380763 CTGAATCCTCAGAGAAGGACAGG - Intergenic
1059362147 9:113753269-113753291 TTTTATCCCCAGAGAGAGGATGG - Intergenic
1059408152 9:114115180-114115202 CTGAATCCCAAAAGGGAGGAGGG + Intergenic
1059990287 9:119858837-119858859 CAGAATCCTCAGTGAAAAGATGG - Intergenic
1061126865 9:128682641-128682663 CTTGAGCCTCAGAGACAGGATGG + Intergenic
1061405949 9:130393189-130393211 CTGAATCCCCCGAGAGGAGAGGG - Intronic
1061606287 9:131713350-131713372 CAGATTCCTCAGAGAGGGGCAGG + Intronic
1061648564 9:132027138-132027160 CTGAATCAACGGAGTGAGGATGG + Intronic
1061705142 9:132447294-132447316 CTGCATCCCCAGAAAGAGGCAGG - Intronic
1062101460 9:134730754-134730776 CTGAATCCTCAAAGACCGGAAGG - Intronic
1062379391 9:136279938-136279960 CTGCATCAACACAGAGAGGAAGG - Intergenic
1062424288 9:136498838-136498860 CTGAATCCACAGAGAAGTGAGGG - Intronic
1185469734 X:375174-375196 CTGAATCCTCAAGGACAGTAAGG - Intronic
1185478105 X:427315-427337 CTGATGCCCCAGAGACAGGACGG + Intergenic
1185478124 X:427396-427418 CTGATGCCCCAGAGACAGGACGG + Intergenic
1186678356 X:11844802-11844824 CAGAATCATCAAAGAGAGAAAGG - Intergenic
1187948364 X:24448225-24448247 CTGAATCCTCACATGGTGGAAGG + Intergenic
1188285865 X:28324841-28324863 CTAAATCCACAGACAGAAGAGGG + Intergenic
1188649713 X:32617058-32617080 CTGAATCCACAGACAGAGAAAGG + Intronic
1188828139 X:34862128-34862150 CCAACTCCTGAGAGAGAGGAAGG - Intergenic
1189236396 X:39490456-39490478 TAGAGTCTTCAGAGAGAGGATGG + Intergenic
1189425953 X:40900140-40900162 CTGACACCTCAGGGAGAGGATGG - Intergenic
1189963634 X:46349834-46349856 CTGTATCCTCACAGAGCAGAAGG + Intergenic
1190770717 X:53511709-53511731 GTGAATCTTCAGAGAGTGAAGGG + Intergenic
1190953736 X:55171524-55171546 ATGAATCCTCCCACAGAGGACGG + Intronic
1191885635 X:65885031-65885053 CTGCATCCTCAGATGGTGGAAGG - Intergenic
1192179151 X:68905147-68905169 CTGAAGCCAGAGAGAGGGGAAGG - Intergenic
1193042227 X:77016105-77016127 CCAAATCCTCAAAGGGAGGAAGG + Intergenic
1193350542 X:80458843-80458865 CTAAATCCTCACAGATAGTACGG + Intergenic
1195966247 X:110432627-110432649 CGGGATCCTCAGGGACAGGAGGG - Intronic
1196167993 X:112555965-112555987 CAGACTCCTCAGAGCGAGCAAGG - Intergenic
1196293798 X:113976663-113976685 GTGAATCTTCAGAGAGTGAAGGG + Intergenic
1196617820 X:117787424-117787446 CTGAATCATCAGAAAGTGGCGGG + Intergenic
1199585255 X:149408248-149408270 CTGTATCCTCACATAGTGGAAGG - Intergenic
1199837153 X:151602802-151602824 GTGAAGCCTGAGAGACAGGAAGG - Intronic
1199898301 X:152147384-152147406 CTGAATCCTGACATGGAGGAAGG - Intergenic
1199996102 X:153027878-153027900 CAGAAGCCTCAGATAGATGAGGG - Intergenic