ID: 902175611

View in Genome Browser
Species Human (GRCh38)
Location 1:14647984-14648006
Sequence CAACTATCCCAGCCAAGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 109}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902175603_902175611 12 Left 902175603 1:14647949-14647971 CCTTCCCAGCTGACCTTTCTGTT 0: 1
1: 0
2: 4
3: 37
4: 332
Right 902175611 1:14647984-14648006 CAACTATCCCAGCCAAGGTCAGG 0: 1
1: 0
2: 0
3: 7
4: 109
902175601_902175611 28 Left 902175601 1:14647933-14647955 CCTGATCTGCCAAGGTCCTTCCC 0: 1
1: 0
2: 3
3: 15
4: 209
Right 902175611 1:14647984-14648006 CAACTATCCCAGCCAAGGTCAGG 0: 1
1: 0
2: 0
3: 7
4: 109
902175602_902175611 19 Left 902175602 1:14647942-14647964 CCAAGGTCCTTCCCAGCTGACCT 0: 1
1: 0
2: 2
3: 29
4: 291
Right 902175611 1:14647984-14648006 CAACTATCCCAGCCAAGGTCAGG 0: 1
1: 0
2: 0
3: 7
4: 109
902175606_902175611 -1 Left 902175606 1:14647962-14647984 CCTTTCTGTTTCCTCTGTTGCCC 0: 1
1: 1
2: 3
3: 56
4: 607
Right 902175611 1:14647984-14648006 CAACTATCCCAGCCAAGGTCAGG 0: 1
1: 0
2: 0
3: 7
4: 109
902175605_902175611 7 Left 902175605 1:14647954-14647976 CCAGCTGACCTTTCTGTTTCCTC 0: 1
1: 0
2: 5
3: 41
4: 462
Right 902175611 1:14647984-14648006 CAACTATCCCAGCCAAGGTCAGG 0: 1
1: 0
2: 0
3: 7
4: 109
902175604_902175611 8 Left 902175604 1:14647953-14647975 CCCAGCTGACCTTTCTGTTTCCT 0: 1
1: 0
2: 3
3: 52
4: 537
Right 902175611 1:14647984-14648006 CAACTATCCCAGCCAAGGTCAGG 0: 1
1: 0
2: 0
3: 7
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902175611 Original CRISPR CAACTATCCCAGCCAAGGTC AGG Intronic
900507006 1:3034764-3034786 CAACAAACCCAGCAAAGGGCAGG - Intergenic
901228533 1:7629150-7629172 CAACAATCTCATCCAAGCTCAGG + Intronic
901229411 1:7633600-7633622 CAGCTCCCCCAGCCAAGGCCAGG + Intronic
902175611 1:14647984-14648006 CAACTATCCCAGCCAAGGTCAGG + Intronic
902281901 1:15380929-15380951 CTACTATCCCAGCATGGGTCAGG + Intronic
906148230 1:43572521-43572543 CAACGGTCCCAGGCCAGGTCAGG - Intronic
906550771 1:46664924-46664946 CAACGTTCCTAGCCTAGGTCAGG + Intronic
906875974 1:49539790-49539812 CATCTTTCCCAGCTAAGGTCAGG - Intronic
907543016 1:55233741-55233763 CAACTCTCCCAGCGAGAGTCAGG - Intergenic
908338265 1:63149433-63149455 CAACTACCCCACCCAAGGCAGGG - Intergenic
911084710 1:93966687-93966709 CATCTATGCCAACCAAGGACTGG - Intergenic
915092770 1:153438150-153438172 AAGCTCTCCCAGCCAAGGGCGGG + Intronic
915631005 1:157154306-157154328 CCAGAATCCCAGCCAAGGGCAGG - Intergenic
917325025 1:173823630-173823652 GAACTAGCCCTGCCAAGCTCAGG - Intronic
919685530 1:200479925-200479947 CATCCCTCCCAGCCCAGGTCAGG + Intergenic
920785092 1:209033609-209033631 CAACTGTCCCAGCCTCAGTCTGG - Intergenic
1063555372 10:7074199-7074221 CAACAATCCCAGGCAAGTTATGG + Intergenic
1063654614 10:7975444-7975466 CAGCTAACCCAGCTAAGGGCAGG - Intronic
1074872128 10:117585496-117585518 CAAGTCACACAGCCAAGGTCAGG - Intergenic
1075072871 10:119330671-119330693 TAACTAGCCCTGCCAAGGCCTGG + Intronic
1078929661 11:15903431-15903453 CAACTCTCCTAACCTAGGTCAGG + Intergenic
1079622611 11:22572406-22572428 CAGCTGTCCCAACCAAGGTCTGG - Intergenic
1083820490 11:65168575-65168597 CACCTCTCCCAGCCAAGTTAAGG + Intergenic
1085113001 11:73904845-73904867 CGAGCATCCCAGCCAAAGTCTGG - Intronic
1087203862 11:95373438-95373460 GAACTATGCCAGCAAAGGCCTGG + Intergenic
1090192687 11:124785604-124785626 CAACTGTCTCACCCAAGGTGAGG - Intronic
1092412947 12:8268182-8268204 CGACTGTCCCAGCCAAACTCTGG + Intergenic
1094458822 12:30671003-30671025 CAACTATCTCAACCAAGGGGTGG - Exonic
1098132474 12:67364882-67364904 GCACTATCAAAGCCAAGGTCAGG + Intergenic
1101458361 12:104861312-104861334 CAACAATCCCAACCAAGTTTGGG + Exonic
1102459516 12:113091701-113091723 CAACTGTGCCTGCCAAGGACAGG + Intronic
1105516225 13:21093350-21093372 CAACTACCACAGCAAGGGTCTGG - Intergenic
1106132536 13:26952112-26952134 CCAAGATCACAGCCAAGGTCAGG + Intergenic
1110683812 13:78348148-78348170 CAACAATCCCAGCTAAGCTCAGG - Intergenic
1113471123 13:110547196-110547218 GAACTAGAGCAGCCAAGGTCAGG + Intronic
1113774611 13:112935989-112936011 CAACATGCCCAGCCAAGGGCTGG - Intronic
1117199572 14:53374466-53374488 CAGTTATCCGAGCCAATGTCTGG + Intergenic
1121854364 14:97253092-97253114 AAACAATCCCAGCCAAGCCCAGG - Intergenic
1124828454 15:33124009-33124031 CAACTATTCCAGCAAAGGACTGG + Intronic
1131194298 15:90342821-90342843 CATCTATGCCTGCCAAGATCTGG - Intergenic
1131257831 15:90873244-90873266 CAACAACCCCAGCCATGGTGAGG - Intronic
1133454734 16:5932098-5932120 CAACTATGCCATACAAGGCCAGG - Intergenic
1133622915 16:7543408-7543430 CAGCTATCACTGCCAAGGACTGG + Intronic
1134756822 16:16674565-16674587 CCACTTTCCCTGCCAACGTCAGG - Intergenic
1134989246 16:18684598-18684620 CCACTTTCCCTGCCAACGTCAGG + Intergenic
1139828492 16:69776942-69776964 CAACAATCCCATCTAAGGTAGGG - Intronic
1139848669 16:69937666-69937688 CAAATGTCCCTGCCAAGGCCTGG - Intronic
1139852844 16:69961353-69961375 CCACAAGCCCAGGCAAGGTCTGG - Intronic
1139881815 16:70184261-70184283 CCACAAGCCCAGGCAAGGTCTGG - Intronic
1140370694 16:74411245-74411267 CCACAAGCCCAGGCAAGGTCTGG + Intronic
1141004535 16:80339822-80339844 CATCTAGCCCACCCGAGGTCAGG + Intergenic
1145231086 17:21173698-21173720 CAGCTGTCCCTGCAAAGGTCTGG - Intronic
1146952516 17:36916676-36916698 TCACTATCCCAGGGAAGGTCGGG - Intergenic
1147421661 17:40324896-40324918 CAGCTATCCCAGCCACCCTCAGG + Intronic
1151545639 17:74791277-74791299 CAGCTACTCCAGCCAGGGTCAGG + Intronic
1151572735 17:74935418-74935440 CAACTCTCCCCACCAAGTTCAGG + Intergenic
1151683277 17:75633060-75633082 CGGCTGTCCCAGCCCAGGTCAGG - Intronic
1153802462 18:8683209-8683231 CAACTGACCCAGCCTGGGTCAGG - Intergenic
1160458180 18:79017777-79017799 CAAATCTCCCAGCTTAGGTCTGG + Intergenic
1162456574 19:10788586-10788608 GACCTAACCTAGCCAAGGTCTGG - Intronic
1165743409 19:38216892-38216914 CGAGTACCCCAGCCAAGATCTGG + Intronic
1167102310 19:47411284-47411306 CAACCATCCTAGGCAGGGTCTGG + Intronic
1167606327 19:50482657-50482679 CACCTAGCCCAGCCAGGGACAGG - Exonic
927359046 2:22210045-22210067 CCACTGTCCCACCCAAGGGCAGG - Intergenic
927868092 2:26605824-26605846 CAACTAGCCAAACGAAGGTCAGG + Intronic
931068696 2:58619499-58619521 CAACCACCCCAGTCAAGGTATGG - Intergenic
931709922 2:64979850-64979872 CAGCAAACCCAGCCAAGATCAGG - Intergenic
938245867 2:129777368-129777390 CAGCTGCCCCAGCCCAGGTCAGG + Intergenic
938451940 2:131428741-131428763 CTGCTCTACCAGCCAAGGTCTGG - Intergenic
941613940 2:167697362-167697384 CAACCATCACAGCCCAGGTGTGG - Intergenic
947338364 2:229110740-229110762 CCAACATCCCAGCCAAGGACTGG - Intronic
947718071 2:232351734-232351756 GACCTACCCCAGCCAAGGCCGGG + Intergenic
1170470308 20:16661976-16661998 CCACTCTCCCAGCCAAGGGGGGG - Intergenic
1170775041 20:19367752-19367774 GAAACATCCCAGACAAGGTCTGG + Intronic
1171472148 20:25380786-25380808 CACCTGTCACAGCCATGGTCAGG + Intronic
1172601975 20:36190380-36190402 CCATTACCCCATCCAAGGTCAGG - Intronic
1176128741 20:63487395-63487417 CACTCTTCCCAGCCAAGGTCGGG + Intergenic
1181681282 22:24497506-24497528 CACCTCTCCCACCCAGGGTCAGG - Intronic
1182529446 22:30944090-30944112 CAACTATTCAACCCAAGGGCTGG + Intronic
1184464494 22:44660776-44660798 CCACTATCACAAACAAGGTCAGG - Intergenic
953822603 3:46221524-46221546 AACATAGCCCAGCCAAGGTCAGG - Intronic
954618136 3:51980723-51980745 CAACTCTTCCATCCAAGGTCAGG - Intronic
961890510 3:130126835-130126857 CGACTGTCCCAGCCAAACTCTGG + Intergenic
963008485 3:140748450-140748472 CAACAAAGCCAGGCAAGGTCAGG + Intergenic
963268636 3:143264470-143264492 CAGGTATCCCAGCCAACTTCAGG - Intergenic
966519153 3:180854571-180854593 CCACCATCTCAGCTAAGGTCTGG - Intronic
968705746 4:2076636-2076658 CATCTGTGCCAGCCAAGGACGGG - Intronic
969202369 4:5616212-5616234 GAACTTTCCCAGCACAGGTCTGG + Intronic
970314072 4:14812717-14812739 CAAAGACCCCAGTCAAGGTCTGG + Intergenic
971643582 4:29166668-29166690 CAGCTATCCCAGCAATGGACCGG + Intergenic
975252960 4:72200695-72200717 CAACTATCCCTCCCAGGCTCTGG - Intergenic
976720312 4:88163025-88163047 CAATTTTCCCTGGCAAGGTCAGG + Intronic
999848897 5:155516048-155516070 CAACTATCCCAGGGATGGGCAGG + Intergenic
1002914547 6:1518506-1518528 CATCTCCCCCAGCCAAAGTCTGG - Intergenic
1003991398 6:11490191-11490213 AAGTTATCCCAGCCAAGGTCAGG + Intergenic
1005264544 6:24097953-24097975 CAACTATCCCAAACAAGGAGAGG - Intergenic
1005450477 6:25967109-25967131 CAACCATCCCATTGAAGGTCAGG - Intronic
1006354200 6:33544499-33544521 TAATTATCCCATCCAAGGCCAGG + Intergenic
1007598273 6:43065455-43065477 CAAGTGGCCCAGCCAAGCTCAGG - Intronic
1017258793 6:152363839-152363861 CAGTTATCCCATCCAAGGGCAGG - Intronic
1019664782 7:2246386-2246408 ACACTCTCCCAGCCAACGTCAGG - Intronic
1020588989 7:10110300-10110322 GAAGTATCCAAGCAAAGGTCAGG + Intergenic
1022383658 7:29883550-29883572 CTAGTATCCCAGCCAGGGCCAGG - Intronic
1026454310 7:70557374-70557396 CACCTCTGCCAGCCAAGGGCTGG - Intronic
1036442505 8:8793897-8793919 CACCGTGCCCAGCCAAGGTCAGG - Intronic
1036612324 8:10361028-10361050 CAACTCTATCAGCCAAGGTGAGG - Intronic
1044262605 8:90144791-90144813 CAACTATCCTTGCCAAACTCTGG + Intergenic
1047257713 8:123228216-123228238 CCACTGTACCAGCCTAGGTCAGG + Intronic
1049571320 8:143371525-143371547 TAGTTATCCCAGCCCAGGTCTGG - Intronic
1056440854 9:86619743-86619765 TAACTATACCAGGCAGGGTCAGG + Intergenic
1056780214 9:89543607-89543629 AAAATCACCCAGCCAAGGTCTGG + Intergenic
1061212042 9:129199318-129199340 CAGATGTCCCAGCCCAGGTCTGG + Intergenic
1061264923 9:129499289-129499311 CCACTACCCCAGCCACTGTCTGG - Intergenic
1061368951 9:130187203-130187225 CAGGTATCCCAGTCAAGGTCAGG + Intronic
1061943134 9:133893647-133893669 CACCCAGCCCAGCCAAGGCCAGG + Intronic
1061954993 9:133956742-133956764 CAGCTGGGCCAGCCAAGGTCAGG + Intronic
1195715278 X:107812353-107812375 CACCTAACCCAGCCCAGGACAGG + Intergenic